ID: 1180482805

View in Genome Browser
Species Human (GRCh38)
Location 22:15770637-15770659
Sequence TGAGTTGTCGATTTGTTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180482805_1180482808 -4 Left 1180482805 22:15770637-15770659 CCCAGCAACAAATCGACAACTCA No data
Right 1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG No data
1180482805_1180482809 -3 Left 1180482805 22:15770637-15770659 CCCAGCAACAAATCGACAACTCA No data
Right 1180482809 22:15770657-15770679 TCAGCCAGCACTAAAAGTTGGGG No data
1180482805_1180482811 29 Left 1180482805 22:15770637-15770659 CCCAGCAACAAATCGACAACTCA No data
Right 1180482811 22:15770689-15770711 ATTAAAAGAAAAATGTATCAAGG No data
1180482805_1180482807 -5 Left 1180482805 22:15770637-15770659 CCCAGCAACAAATCGACAACTCA No data
Right 1180482807 22:15770655-15770677 ACTCAGCCAGCACTAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180482805 Original CRISPR TGAGTTGTCGATTTGTTGCT GGG (reversed) Intergenic
No off target data available for this crispr