ID: 1180482808

View in Genome Browser
Species Human (GRCh38)
Location 22:15770656-15770678
Sequence CTCAGCCAGCACTAAAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180482804_1180482808 0 Left 1180482804 22:15770633-15770655 CCATCCCAGCAACAAATCGACAA No data
Right 1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG No data
1180482805_1180482808 -4 Left 1180482805 22:15770637-15770659 CCCAGCAACAAATCGACAACTCA No data
Right 1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG No data
1180482806_1180482808 -5 Left 1180482806 22:15770638-15770660 CCAGCAACAAATCGACAACTCAG No data
Right 1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180482808 Original CRISPR CTCAGCCAGCACTAAAAGTT GGG Intergenic
No off target data available for this crispr