ID: 1180485519

View in Genome Browser
Species Human (GRCh38)
Location 22:15792149-15792171
Sequence GGGTGGGTCATTTCAAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180485512_1180485519 0 Left 1180485512 22:15792126-15792148 CCAACCATGTGCGGACGGACATG No data
Right 1180485519 22:15792149-15792171 GGGTGGGTCATTTCAAAGTGAGG No data
1180485516_1180485519 -4 Left 1180485516 22:15792130-15792152 CCATGTGCGGACGGACATGGGGT No data
Right 1180485519 22:15792149-15792171 GGGTGGGTCATTTCAAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180485519 Original CRISPR GGGTGGGTCATTTCAAAGTG AGG Intergenic
No off target data available for this crispr