ID: 1180488140

View in Genome Browser
Species Human (GRCh38)
Location 22:15819923-15819945
Sequence GGCTCAGTGGGCAAAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180488140_1180488151 23 Left 1180488140 22:15819923-15819945 CCCCTCTCTTTGCCCACTGAGCC No data
Right 1180488151 22:15819969-15819991 TGCCTCTGGCCGCGTCCGCTTGG No data
1180488140_1180488152 24 Left 1180488140 22:15819923-15819945 CCCCTCTCTTTGCCCACTGAGCC No data
Right 1180488152 22:15819970-15819992 GCCTCTGGCCGCGTCCGCTTGGG No data
1180488140_1180488146 -9 Left 1180488140 22:15819923-15819945 CCCCTCTCTTTGCCCACTGAGCC No data
Right 1180488146 22:15819937-15819959 CACTGAGCCCGCGGCCTGCGTGG No data
1180488140_1180488154 30 Left 1180488140 22:15819923-15819945 CCCCTCTCTTTGCCCACTGAGCC No data
Right 1180488154 22:15819976-15819998 GGCCGCGTCCGCTTGGGACAAGG No data
1180488140_1180488150 9 Left 1180488140 22:15819923-15819945 CCCCTCTCTTTGCCCACTGAGCC No data
Right 1180488150 22:15819955-15819977 CGTGGTGCTGAGACTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180488140 Original CRISPR GGCTCAGTGGGCAAAGAGAG GGG (reversed) Intergenic
No off target data available for this crispr