ID: 1180497333

View in Genome Browser
Species Human (GRCh38)
Location 22:15902377-15902399
Sequence CTGCGGCAGGCAGTGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180497333_1180497340 3 Left 1180497333 22:15902377-15902399 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180497340 22:15902403-15902425 TGCCTCACAGCCTCAAAGGCAGG No data
1180497333_1180497344 16 Left 1180497333 22:15902377-15902399 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180497344 22:15902416-15902438 CAAAGGCAGGCCTGCCCTCCGGG No data
1180497333_1180497347 30 Left 1180497333 22:15902377-15902399 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180497347 22:15902430-15902452 CCCTCCGGGCACCTCTACCCAGG No data
1180497333_1180497337 -1 Left 1180497333 22:15902377-15902399 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180497337 22:15902399-15902421 GCCCTGCCTCACAGCCTCAAAGG No data
1180497333_1180497343 15 Left 1180497333 22:15902377-15902399 CCACTGGCCACTGCCTGCCGCAG No data
Right 1180497343 22:15902415-15902437 TCAAAGGCAGGCCTGCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180497333 Original CRISPR CTGCGGCAGGCAGTGGCCAG TGG (reversed) Intergenic
No off target data available for this crispr