ID: 1180499999

View in Genome Browser
Species Human (GRCh38)
Location 22:15922412-15922434
Sequence CAGAGGACACAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180499999_1180500016 30 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500016 22:15922465-15922487 TCCTGGATGCAGGGCATCCTGGG No data
1180499999_1180500005 4 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500005 22:15922439-15922461 AGCCACAGCCCAGGAAGCCAAGG No data
1180499999_1180500009 13 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500009 22:15922448-15922470 CCAGGAAGCCAAGGCCCTCCTGG No data
1180499999_1180500015 29 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500015 22:15922464-15922486 CTCCTGGATGCAGGGCATCCTGG No data
1180499999_1180500004 -5 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500004 22:15922430-15922452 CTCTGTGCAAGCCACAGCCCAGG No data
1180499999_1180500012 21 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500012 22:15922456-15922478 CCAAGGCCCTCCTGGATGCAGGG No data
1180499999_1180500010 20 Left 1180499999 22:15922412-15922434 CCTCCCTCCTTCTGTGTCCTCTG No data
Right 1180500010 22:15922455-15922477 GCCAAGGCCCTCCTGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180499999 Original CRISPR CAGAGGACACAGAAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr