ID: 1180511814

View in Genome Browser
Species Human (GRCh38)
Location 22:16098684-16098706
Sequence ATGGGTAAATCATCTGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180511814_1180511822 7 Left 1180511814 22:16098684-16098706 CCGACCTCAGATGATTTACCCAT No data
Right 1180511822 22:16098714-16098736 TCCCAAGGTGCCGGGATTACAGG 0: 18
1: 5500
2: 298449
3: 319410
4: 298228
1180511814_1180511819 -2 Left 1180511814 22:16098684-16098706 CCGACCTCAGATGATTTACCCAT No data
Right 1180511819 22:16098705-16098727 ATCTCAGCCTCCCAAGGTGCCGG 0: 41
1: 2733
2: 41991
3: 167483
4: 365929
1180511814_1180511820 -1 Left 1180511814 22:16098684-16098706 CCGACCTCAGATGATTTACCCAT No data
Right 1180511820 22:16098706-16098728 TCTCAGCCTCCCAAGGTGCCGGG No data
1180511814_1180511826 26 Left 1180511814 22:16098684-16098706 CCGACCTCAGATGATTTACCCAT No data
Right 1180511826 22:16098733-16098755 CAGGCGTGAGCCACCATGCCTGG 0: 7414
1: 43495
2: 117154
3: 175476
4: 212017
1180511814_1180511816 -8 Left 1180511814 22:16098684-16098706 CCGACCTCAGATGATTTACCCAT No data
Right 1180511816 22:16098699-16098721 TTACCCATCTCAGCCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180511814 Original CRISPR ATGGGTAAATCATCTGAGGT CGG (reversed) Intergenic
No off target data available for this crispr