ID: 1180514579

View in Genome Browser
Species Human (GRCh38)
Location 22:16129726-16129748
Sequence AATTATCTGGACATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180514572_1180514579 20 Left 1180514572 22:16129683-16129705 CCTGGCCAAAATGGTGAAACCCC 0: 1271
1: 78157
2: 163801
3: 197281
4: 152495
Right 1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG No data
1180514576_1180514579 -1 Left 1180514576 22:16129704-16129726 CCGTCTCTACTAAAAAGACAAAA 0: 650
1: 203548
2: 144285
3: 71660
4: 58285
Right 1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG No data
1180514574_1180514579 1 Left 1180514574 22:16129702-16129724 CCCCGTCTCTACTAAAAAGACAA 0: 287
1: 102713
2: 224660
3: 158461
4: 94872
Right 1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG No data
1180514575_1180514579 0 Left 1180514575 22:16129703-16129725 CCCGTCTCTACTAAAAAGACAAA 0: 509
1: 171511
2: 215972
3: 132280
4: 86118
Right 1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG No data
1180514573_1180514579 15 Left 1180514573 22:16129688-16129710 CCAAAATGGTGAAACCCCGTCTC 0: 623
1: 42073
2: 138721
3: 143538
4: 90292
Right 1180514579 22:16129726-16129748 AATTATCTGGACATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180514579 Original CRISPR AATTATCTGGACATGATGGC AGG Intergenic
No off target data available for this crispr