ID: 1180516681

View in Genome Browser
Species Human (GRCh38)
Location 22:16150969-16150991
Sequence ACCTAGGAGAAACTCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180516678_1180516681 -3 Left 1180516678 22:16150949-16150971 CCATACAAAGGTCTGACCAGACC 0: 40
1: 82
2: 96
3: 77
4: 128
Right 1180516681 22:16150969-16150991 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180516681 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG Intergenic
No off target data available for this crispr