ID: 1180522623

View in Genome Browser
Species Human (GRCh38)
Location 22:16223884-16223906
Sequence CAGATCCAGCAGAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180522622_1180522623 -2 Left 1180522622 22:16223863-16223885 CCTATGTGAGGGACAAACACTCA No data
Right 1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG No data
1180522618_1180522623 20 Left 1180522618 22:16223841-16223863 CCCAGCAGCAGTGTTCTGGAATC No data
Right 1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG No data
1180522619_1180522623 19 Left 1180522619 22:16223842-16223864 CCAGCAGCAGTGTTCTGGAATCC No data
Right 1180522623 22:16223884-16223906 CAGATCCAGCAGAAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180522623 Original CRISPR CAGATCCAGCAGAAGTGTTC TGG Intergenic
No off target data available for this crispr