ID: 1180538709

View in Genome Browser
Species Human (GRCh38)
Location 22:16421172-16421194
Sequence GTTCTAAGTGTATGACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180538707_1180538709 5 Left 1180538707 22:16421144-16421166 CCAGCATGAGAAGGTAATATATT No data
Right 1180538709 22:16421172-16421194 GTTCTAAGTGTATGACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180538709 Original CRISPR GTTCTAAGTGTATGACAATC TGG Intergenic
No off target data available for this crispr