ID: 1180542164

View in Genome Browser
Species Human (GRCh38)
Location 22:16459506-16459528
Sequence CAACATAAACATACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180542164_1180542167 13 Left 1180542164 22:16459506-16459528 CCCAGCTCTGTATGTTTATGTTG No data
Right 1180542167 22:16459542-16459564 CAACCAGTTGTTTATTAGGATGG No data
1180542164_1180542169 22 Left 1180542164 22:16459506-16459528 CCCAGCTCTGTATGTTTATGTTG No data
Right 1180542169 22:16459551-16459573 GTTTATTAGGATGGCCAAAAAGG No data
1180542164_1180542166 9 Left 1180542164 22:16459506-16459528 CCCAGCTCTGTATGTTTATGTTG No data
Right 1180542166 22:16459538-16459560 AGAGCAACCAGTTGTTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180542164 Original CRISPR CAACATAAACATACAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr