ID: 1180547238

View in Genome Browser
Species Human (GRCh38)
Location 22:16513283-16513305
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180547230_1180547238 15 Left 1180547230 22:16513245-16513267 CCCACTGGCCCCTAGCTAGAGGT No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data
1180547231_1180547238 14 Left 1180547231 22:16513246-16513268 CCACTGGCCCCTAGCTAGAGGTG No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data
1180547228_1180547238 28 Left 1180547228 22:16513232-16513254 CCATGGAGCTGTTCCCACTGGCC No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data
1180547233_1180547238 6 Left 1180547233 22:16513254-16513276 CCCTAGCTAGAGGTGAGTGTAGG No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data
1180547232_1180547238 7 Left 1180547232 22:16513253-16513275 CCCCTAGCTAGAGGTGAGTGTAG No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data
1180547235_1180547238 5 Left 1180547235 22:16513255-16513277 CCTAGCTAGAGGTGAGTGTAGGA No data
Right 1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180547238 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr