ID: 1180548124

View in Genome Browser
Species Human (GRCh38)
Location 22:16520614-16520636
Sequence TATGGAGCAGTCGCCGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180548120_1180548124 -9 Left 1180548120 22:16520600-16520622 CCGGACCCCGTGGATATGGAGCA No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data
1180548112_1180548124 15 Left 1180548112 22:16520576-16520598 CCCTTAGCTCCAGGTGGACGCGG No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data
1180548114_1180548124 14 Left 1180548114 22:16520577-16520599 CCTTAGCTCCAGGTGGACGCGGC No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data
1180548119_1180548124 -8 Left 1180548119 22:16520599-16520621 CCCGGACCCCGTGGATATGGAGC No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data
1180548116_1180548124 6 Left 1180548116 22:16520585-16520607 CCAGGTGGACGCGGCCCGGACCC No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data
1180548109_1180548124 29 Left 1180548109 22:16520562-16520584 CCTAGCTGGCGGGACCCTTAGCT No data
Right 1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180548124 Original CRISPR TATGGAGCAGTCGCCGCCCC CGG Intergenic
No off target data available for this crispr