ID: 1180548970

View in Genome Browser
Species Human (GRCh38)
Location 22:16526991-16527013
Sequence CCTGGCACGGAGCAGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180548970_1180548981 29 Left 1180548970 22:16526991-16527013 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548970_1180548980 28 Left 1180548970 22:16526991-16527013 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180548970 Original CRISPR CCTGGCACGGAGCAGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr