ID: 1180548980

View in Genome Browser
Species Human (GRCh38)
Location 22:16527042-16527064
Sequence CACCATGACTTGCCTCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 8, 2: 3, 3: 34, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180548974_1180548980 24 Left 1180548974 22:16526995-16527017 CCAGCTGCTCCGTGCCAGGAGGA No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548977_1180548980 10 Left 1180548977 22:16527009-16527031 CCAGGAGGAGGAAGAGACACCTA 0: 1
1: 30
2: 15
3: 23
4: 271
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548972_1180548980 25 Left 1180548972 22:16526994-16527016 CCCAGCTGCTCCGTGCCAGGAGG No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548976_1180548980 15 Left 1180548976 22:16527004-16527026 CCGTGCCAGGAGGAGGAAGAGAC 0: 1
1: 32
2: 10
3: 45
4: 395
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548970_1180548980 28 Left 1180548970 22:16526991-16527013 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548978_1180548980 -9 Left 1180548978 22:16527028-16527050 CCTAGAGCCTGCGACACCATGAC No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223
1180548969_1180548980 29 Left 1180548969 22:16526990-16527012 CCCGCCCAGCTGCTCCGTGCCAG No data
Right 1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG 0: 1
1: 8
2: 3
3: 34
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180548980 Original CRISPR CACCATGACTTGCCTCACTG CGG Intergenic
902174932 1:14642109-14642131 CACCATGCCTGGCCTCACTGTGG - Intronic
902832565 1:19026671-19026693 CACCATGCCTGGCCTAAGTGGGG + Intergenic
903410286 1:23137350-23137372 CACCATGCCTCGCCTCACTTTGG - Intronic
904433373 1:30479279-30479301 CACCATGGCTTGTGTGACTGAGG - Intergenic
904884446 1:33725799-33725821 CACAATGACTAGCCTCATGGAGG + Intronic
906061695 1:42953215-42953237 CACACTGACTTGCCTCCCTGAGG - Intronic
911514213 1:98847110-98847132 CATCATGCCTGGCCTCATTGTGG + Intergenic
911771272 1:101745207-101745229 CACCACGCCTGGCCTCACTTGGG + Intergenic
912433298 1:109641155-109641177 CACCATGCCTGGCCTTTCTGGGG + Intergenic
913478603 1:119262935-119262957 AACTATGACTTACCTCACCGGGG - Intergenic
913616466 1:120564970-120564992 CCCCATTACTTCCCTCTCTGAGG - Intergenic
913958786 1:143323836-143323858 CACCATGGCTCGCCTCGCTGCGG - Intergenic
913959019 1:143324831-143324853 CCCACTGGCTTGCCTCACTGTGG - Intergenic
914053103 1:144149216-144149238 CACCATGGCTCGCCTCGCTGCGG - Intergenic
914053336 1:144150211-144150233 CCCACTGGCTTGCCTCACTGTGG - Intergenic
914125861 1:144816330-144816352 CCCACTGGCTTGCCTCACTGTGG + Intergenic
914126094 1:144817325-144817347 CACCATGGCTCGCCTCGCTGCGG + Intergenic
914573811 1:148945941-148945963 CCCCATTACTTCCCTCTCTGAGG + Intronic
917969476 1:180197639-180197661 AACCATGGCTTGCCTCACCTGGG - Exonic
918468384 1:184845180-184845202 CAGCATGAGTTGTCTCACTAAGG + Intronic
922547111 1:226466064-226466086 CACCCTGCCTCGGCTCACTGGGG + Intergenic
923277679 1:232412744-232412766 CACCATGACATGCCACCCTATGG + Intronic
1063464081 10:6231972-6231994 CCCCGTGACTTTCCTCCCTGTGG + Intronic
1065078895 10:22108416-22108438 CACCATGCCCGGCCTCATTGTGG + Intergenic
1065936465 10:30524946-30524968 CACCATGCCTGGCCTAAATGTGG - Intergenic
1066758680 10:38735789-38735811 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1066758901 10:38736783-38736805 CACCACGACTCGCCTCGCTGCGG + Intergenic
1066962736 10:42235985-42236007 CACCATGACTTGCCTCGCTGCGG - Intergenic
1067232144 10:44419431-44419453 CACCATCACGTGGCTCACTGTGG - Intergenic
1068028857 10:51683195-51683217 CACCGTGCCTGGCCTCATTGTGG - Intronic
1070550433 10:77486824-77486846 CTCCATGACTTGCCTGCTTGGGG - Intronic
1071456389 10:85854591-85854613 CCACATCACTGGCCTCACTGGGG - Exonic
1073680984 10:105703205-105703227 CACCTTGTCTGGCCTCAGTGGGG - Intergenic
1074711677 10:116183235-116183257 CACCAAGTCTTGTCTGACTGAGG - Intronic
1077594639 11:3521422-3521444 CACCATGCCTGGCCACAGTGAGG + Intergenic
1081044059 11:38250188-38250210 CACCCCCACTTGCCACACTGTGG - Intergenic
1084250480 11:67894686-67894708 CACCATGCCTGGCCACAGTGAGG + Intergenic
1084468874 11:69343568-69343590 CACCAGGACCTTCCTCACTCAGG - Intronic
1084822299 11:71700652-71700674 CACCATGCCTGGCCACAGTGAGG - Intergenic
1085625122 11:78065931-78065953 CTCCCTGAGTTGCCTCACAGAGG + Intronic
1085749941 11:79153014-79153036 TTCCATCACTTGCCTTACTGCGG + Intronic
1088270164 11:108026297-108026319 CAGTATGACTGGCCTCATTGTGG - Intronic
1089427141 11:118387639-118387661 CACAATGTCATACCTCACTGTGG - Intronic
1090593557 11:128296568-128296590 TAATAGGACTTGCCTCACTGAGG - Intergenic
1092420811 12:8330208-8330230 CACCATGCCTGGCCACAGTGAGG + Intergenic
1092910879 12:13144026-13144048 CACCATGACATGATTCTCTGAGG - Intergenic
1094162221 12:27403872-27403894 CACCATGCCTGGCCACACGGTGG - Intronic
1096092537 12:48912753-48912775 CAACATGAAGTGCCTCACTGAGG - Intronic
1096243365 12:49971293-49971315 CTCCCCGCCTTGCCTCACTGGGG + Intronic
1097300458 12:58012945-58012967 CACCATGTCTGGCCTCATTCTGG + Intergenic
1098876268 12:75869213-75869235 CACCGTGCCTGGCCACACTGAGG - Intergenic
1101984879 12:109438193-109438215 CACCATGTTTAGTCTCACTGGGG - Intronic
1102059714 12:109923299-109923321 CACAATGACTTCCCCCACAGCGG - Intronic
1102575495 12:113853740-113853762 CCCCAGGAGTAGCCTCACTGAGG - Intronic
1103025341 12:117569512-117569534 CACCATGTCTTACCTTACTAGGG + Intronic
1103087665 12:118073945-118073967 CATGAAGACTTGCTTCACTGGGG - Exonic
1104962421 12:132494520-132494542 CACCATGGCCAGCGTCACTGGGG - Intronic
1105274168 13:18905131-18905153 CACCACGGCTCGCCTCGCTGTGG - Intergenic
1105457146 13:20551556-20551578 CCCCTTGACTTTCTTCACTGGGG + Intergenic
1107462292 13:40615730-40615752 CACCATCCCTTGCCTCTCTTTGG - Intronic
1110819489 13:79897835-79897857 CACCATGCCTTGTCACTCTGGGG + Intergenic
1112119932 13:96398678-96398700 CACCAGGGCATGACTCACTGGGG - Intronic
1112753320 13:102603886-102603908 CACCATCTCTTGCCTCCATGAGG - Intronic
1112999635 13:105619036-105619058 CACAATCACTTTCCTCCCTGAGG + Intergenic
1114651265 14:24286078-24286100 AACCTTGACTTGCCTCAGTTGGG + Intergenic
1118116702 14:62785902-62785924 CACCGTGCCCTGCCTAACTGTGG - Intronic
1119211306 14:72834206-72834228 CTCCATGCCTGGCCTCATTGTGG - Intronic
1119855784 14:77899554-77899576 CACCATCCCATGCCTCACAGAGG - Intronic
1121291074 14:92775925-92775947 CACCGTGACTGGCCTCAATAAGG - Intergenic
1202929390 14_KI270725v1_random:25359-25381 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1123422903 15:20145863-20145885 CCCACTGGCTTGCCTCACTGTGG - Intergenic
1123442102 15:20300487-20300509 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1123442332 15:20301480-20301502 CACCACGGCTCGCCTCGCTGCGG + Intergenic
1123532129 15:21152403-21152425 CCCACTGGCTTGCCTCACTGTGG - Intergenic
1123792730 15:23738575-23738597 CACCATGCCCGGCCTCATTGTGG + Intergenic
1124935135 15:34162900-34162922 CACCATGCCTGGCCTAAATGTGG + Intronic
1125268602 15:37913396-37913418 CATCATGAGTTCCCTCTCTGTGG - Intergenic
1126969247 15:54091095-54091117 AACCATGACCTTCCTCAGTGGGG + Intronic
1129834201 15:78691856-78691878 CACCCTGGCCTGTCTCACTGGGG - Intronic
1132808604 16:1787212-1787234 CCCTATGACCTGCCACACTGGGG - Intronic
1133322007 16:4919995-4920017 CACCGTGCCTGGCCTGACTGAGG - Intronic
1133668409 16:7993847-7993869 CACCATGCCCGACCTCACTGTGG + Intergenic
1136002155 16:27303013-27303035 CACCGTGTCTGGCCTCTCTGAGG - Intergenic
1136622195 16:31436634-31436656 CAGCAGGTCTTGCCGCACTGGGG + Exonic
1136723907 16:32342426-32342448 CACCACGACTTGCCTCACTGCGG - Intergenic
1136842235 16:33548470-33548492 CACCACGACTTGCCTCACTGCGG - Intergenic
1136842471 16:33549464-33549486 CCCACTGGCTTGCCTCACTGTGG - Intergenic
1136925714 16:34371778-34371800 CCCCATGACCTGCCTGAGTGTGG + Intergenic
1136978860 16:35040028-35040050 CCCCATGACCTGCCTGAGTGTGG - Intergenic
1138333407 16:56233527-56233549 CACCATGACTTGCATCCTTATGG - Intronic
1140682692 16:77400755-77400777 CACCACGCCTGGCCTCTCTGTGG + Intronic
1140701458 16:77585470-77585492 CACCATGACGTGAATCACAGAGG - Intergenic
1203002524 16_KI270728v1_random:175339-175361 CACCACGACTTGCCTCACTGCGG + Intergenic
1203123339 16_KI270728v1_random:1557660-1557682 CCCGCTGGCTTGCCTCACTGTGG + Intergenic
1203123565 16_KI270728v1_random:1558655-1558677 CACCACGACTTGCCTCACTGCGG + Intergenic
1203134129 16_KI270728v1_random:1711745-1711767 CACCACGACTTGCCTCACTGCGG + Intergenic
1203152400 16_KI270728v1_random:1848767-1848789 CACCACGACTTGCCTCACTGCGG - Intergenic
1203152636 16_KI270728v1_random:1849761-1849783 CCCACTGGCTTGCCTCACTGTGG - Intergenic
1143361296 17:6373786-6373808 CACCATGCCTGGCCTCTTTGTGG - Intergenic
1145193572 17:20867959-20867981 CACCATGGCTTGCCTCGCTGTGG - Intronic
1145298446 17:21613121-21613143 CACCATGGCTCGCCTCGCTGTGG + Intergenic
1145351802 17:22090231-22090253 CACCATGGCTCGCCTCGCTGTGG - Intergenic
1145403990 17:22569968-22569990 CACCGTGGCTTACCTCGCTGTGG - Intergenic
1145722912 17:27089804-27089826 CACCATGGCTCGCCTCGCTGTGG + Intergenic
1146057258 17:29587731-29587753 CAACAAGACTTTCCTCACTGTGG - Intronic
1148431269 17:47645726-47645748 CACCATGTCTTAACTCACTTAGG + Intergenic
1150864263 17:68833048-68833070 CACCATGCCTTTCCTGAGTGTGG - Intergenic
1152439905 17:80300530-80300552 CACCACGCCTGGCCTCATTGTGG + Intronic
1153489843 18:5635667-5635689 CACCATGACTTCCCTGGCTCTGG + Intergenic
1154416014 18:14175580-14175602 CCCAGTGGCTTGCCTCACTGTGG - Intergenic
1154465872 18:14642383-14642405 CACCACGGCTCGCCTCGCTGTGG - Intergenic
1155202203 18:23527093-23527115 CACCATGCCTGGCCTCAGTAGGG - Intronic
1156273446 18:35558694-35558716 CACCATGCCCAGCCTCATTGTGG + Intergenic
1158206712 18:55001060-55001082 TACTATGACTTGCCTCATTGTGG + Intergenic
1159983998 18:74820353-74820375 CACCATGCTCAGCCTCACTGAGG - Intronic
1166685272 19:44792856-44792878 CACCGTGCCCAGCCTCACTGTGG - Intronic
1168338309 19:55609307-55609329 CACCATGCCTGGCCTGACTTTGG + Intronic
1202692498 1_KI270712v1_random:101639-101661 CACCATGGCTCGCCTCGCTGCGG - Intergenic
1202692734 1_KI270712v1_random:102634-102656 CCCACTGGCTTGCCTCACTGTGG - Intergenic
926184364 2:10677225-10677247 CACCATGCCTGGCCTAACTTTGG + Intronic
930844195 2:55883980-55884002 CAACAAGACTTGCCTCACCTAGG + Intronic
931737568 2:65210913-65210935 CACCATGCCCGGCCTCATTGTGG + Intergenic
931882363 2:66581197-66581219 CACCATCAGTAGCCTCGCTGCGG + Intergenic
933953668 2:87351331-87351353 CCCACTGGCTTGCCTCACTGTGG + Intergenic
933953902 2:87352332-87352354 CACCATGGCTCGCCTCGCTGCGG + Intergenic
934057955 2:88268492-88268514 CACCGTGCCTGGCCTCTCTGAGG - Intergenic
934237873 2:90247584-90247606 CCCACTGGCTTGCCTCACTGTGG + Intergenic
934238102 2:90248575-90248597 CACCATGGCTCGCCTCACTGCGG + Intergenic
934275096 2:91568158-91568180 CACCATGGCTCGCCTCGCTGCGG - Intergenic
934275329 2:91569152-91569174 CCCACTGGCTTGCCTCACTGTGG - Intergenic
934322002 2:91980134-91980156 CCCACTGGCTTGCCTCACTGTGG + Intergenic
934322228 2:91981123-91981145 CACCATGACTCGCCTCACTGCGG + Intergenic
934460516 2:94211914-94211936 CACCACGGCTCGCCTCGCTGCGG + Intergenic
934585427 2:95488892-95488914 CACCATTTCTGGCCTCTCTGAGG - Intergenic
934594038 2:95587864-95587886 CACCATTTCTGGCCTCTCTGAGG + Intergenic
936224452 2:110635237-110635259 CACCGTGGCTCGCCTCGCTGCGG + Intergenic
936580569 2:113696909-113696931 CACCCAGCCTTGCCTCAGTGTGG - Intergenic
938314348 2:130315731-130315753 CACCATGACCTGGTTCACAGAGG - Intergenic
947801435 2:232930627-232930649 CACCACGCCTGGCCTCTCTGGGG + Intronic
948704389 2:239779932-239779954 CTCCATCACCTGCCTGACTGTGG + Intronic
1169019344 20:2317335-2317357 CACCCTGACTTGCAGCGCTGCGG + Exonic
1170866330 20:20161152-20161174 CACCCTGACTTTCCTCCCTAGGG - Intronic
1171781025 20:29417842-29417864 CACCTTGTCCTGTCTCACTGCGG - Intergenic
1172451294 20:35025459-35025481 CACTGTGCCTGGCCTCACTGTGG + Intronic
1173619500 20:44425946-44425968 CACCATGCCCAGCCTCATTGTGG + Intronic
1174118890 20:48247621-48247643 CACTATGTCTGGCCTCAGTGAGG + Intergenic
1174544585 20:51315911-51315933 CACCATGCCTGGCCCCTCTGAGG - Intergenic
1176591412 21:8653958-8653980 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1176649189 21:9530183-9530205 CACCATGGCTCGCCTCGCTGTGG + Intergenic
1176808714 21:13516211-13516233 CACCACGGCTCGCCTCGCTGTGG + Intergenic
1176857330 21:13983714-13983736 CCCAGTGGCTTGCCTCACTGTGG + Intergenic
1176867280 21:14060512-14060534 CCCAGTGGCTTGCCTCACTGTGG - Intergenic
1179110349 21:38440530-38440552 CACCATGCCCGGCCTCACTATGG - Intronic
1180252977 21:46601743-46601765 GACCATGACTGGCTTAACTGAGG - Intronic
1180274260 22:10631069-10631091 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1180548748 22:16526050-16526072 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1180548980 22:16527042-16527064 CACCATGACTTGCCTCACTGCGG + Intergenic
1181305768 22:21916485-21916507 CACCCCCACTTGCCACACTGTGG + Intergenic
1181335149 22:22123573-22123595 CACCGCGGCTCGCCTCACTGTGG - Intergenic
1181355727 22:22294841-22294863 CACCACGGCTTGCCTCGCTGCGG - Intergenic
1181355962 22:22295836-22295858 CCCACTGGCTTGCCTCACTGTGG - Intergenic
1181710095 22:24679246-24679268 CCTCATGCCTTGCCTCGCTGTGG + Intergenic
1182158605 22:28099443-28099465 CACCATGGCTTTACTCACTCTGG - Intronic
1182282774 22:29226705-29226727 GACCATGACATGCCTGACAGGGG - Intronic
1182542369 22:31050951-31050973 CACCCTGCCTTGCCTTCCTGTGG - Intergenic
1182685517 22:32119897-32119919 CACCACGGCTTGCCTCGCTGTGG - Intergenic
1182685906 22:32121561-32121583 CAGCATGGCTCGCCTCACTGTGG - Intergenic
950667662 3:14506930-14506952 CAGCATCACTGGTCTCACTGAGG + Exonic
952093478 3:29920685-29920707 CACCATGACCTGCCTATCTGAGG - Intronic
953370519 3:42384035-42384057 CACAGTGACATGCCTCAATGTGG - Intergenic
954296169 3:49675541-49675563 CACCTTGCCTTTCCTCCCTGAGG - Intronic
955965787 3:64388040-64388062 CACCATGGCTGGCCTCACCCAGG - Intronic
956272780 3:67465561-67465583 CAGCATGACTGGCTGCACTGGGG + Intronic
956472936 3:69587844-69587866 CACCACGCCTGGCCTCCCTGGGG - Intergenic
956782493 3:72615059-72615081 CACCATGACCTGGCAAACTGGGG + Intergenic
957064779 3:75512760-75512782 CACCATGTCTGGCCACAGTGAGG + Intergenic
957242981 3:77682588-77682610 CACCTTGAATAACCTCACTGTGG + Intergenic
960313186 3:116142032-116142054 GAGCATGATTTGCCTCACTGAGG - Intronic
960430879 3:117567145-117567167 CACCCTCACTTGCCTCAGAGAGG - Intergenic
961212968 3:125140046-125140068 CACCATGCCCTGCCTCAGAGTGG + Intronic
961288571 3:125826637-125826659 CACCATGTCTGGCCACAATGAGG - Intergenic
961445817 3:126980975-126980997 CACCATGCCCAGCCTCATTGTGG - Intergenic
961898489 3:130189408-130189430 CACCATGCCTGGCCACAGTGAGG + Intergenic
962679268 3:137781790-137781812 CACCATGTCTGGCCTACCTGGGG + Intergenic
968331921 3:197878169-197878191 CAACATGACTTGCTTGAGTGGGG - Intronic
969009471 4:4049906-4049928 CACCATGCCTGGCCACAGTGAGG + Intergenic
969744879 4:9062408-9062430 CACCATGCCTGGCCACAGTGAGG - Intergenic
969804298 4:9594514-9594536 CACCATGCCTGGCCACAGTGAGG - Intergenic
969997766 4:11331977-11331999 CTCCATGTCTATCCTCACTGGGG + Intergenic
970174086 4:13320859-13320881 GACTATGACTTGCCTCAGAGAGG + Intergenic
972609996 4:40647558-40647580 CACCATGCCCAGCCTCATTGTGG + Intergenic
972655147 4:41056911-41056933 CAACATGACTTGGCTAACTCTGG - Intronic
973073730 4:45897133-45897155 CACCATTTCATGCCCCACTGGGG - Intergenic
975360021 4:73458382-73458404 CACAATCATATGCCTCACTGGGG + Intergenic
976307752 4:83578087-83578109 CACCATACCTGGCCTCACTGTGG + Intronic
977625630 4:99186987-99187009 CACCATGCCTGGCCTGGCTGTGG + Intergenic
979648901 4:123107190-123107212 AACCCTGACTTGCCACATTGAGG - Intronic
981895570 4:149795507-149795529 CACTAGGACTTGCCTAAATGTGG - Intergenic
984864694 4:184271707-184271729 CACCATGCCTGGCCTCACCAAGG - Intergenic
985428486 4:189855054-189855076 CACCATGCCTGGCCACACCGAGG - Intergenic
985447024 4:190028145-190028167 CACCTTGTCCTGTCTCACTGAGG - Intergenic
992845530 5:80743224-80743246 CAGCTTGACTGGCCTGACTGGGG - Intronic
994961494 5:106610222-106610244 CACCATGTCTTTCCCTACTGTGG + Intergenic
996092881 5:119368027-119368049 CACCATTACCTACCTCAGTGGGG - Intronic
996803401 5:127428112-127428134 CACCATGGCCTGCCTCAGTCTGG - Intronic
998462184 5:142317897-142317919 CACGATGACTTGGCTCTCTGGGG + Intronic
998757736 5:145399217-145399239 CACTATGAGTTTCCTCAATGTGG + Intergenic
999196320 5:149784009-149784031 CCCCCTGACTTGCCTGCCTGTGG + Intronic
999327476 5:150651994-150652016 CACCACCCCTTGCCCCACTGGGG - Exonic
999335492 5:150712579-150712601 CACCATGCCTGGCCATACTGTGG + Intronic
1001232757 5:170003601-170003623 CTCCATGGCTTCACTCACTGTGG - Intronic
1003474672 6:6470475-6470497 CTCCATGCCTTGCCTCCCGGGGG + Intergenic
1003494051 6:6648593-6648615 CTCCATGACCTGCCACCCTGTGG + Intronic
1003512750 6:6795118-6795140 CACCATTACAGGCCACACTGAGG - Intergenic
1007470287 6:42085694-42085716 CACCGTGCCTGGCCTCCCTGGGG - Intronic
1007714085 6:43844334-43844356 CACCATGCCTGGCCTCAATAGGG + Intergenic
1010754279 6:79649103-79649125 CATTATGACTTCCCTCACTTGGG - Intronic
1010832413 6:80547084-80547106 AGCCATGACCTCCCTCACTGAGG - Intergenic
1011285070 6:85714507-85714529 CACCATGCCTGGCCTCAATGTGG + Intergenic
1012132447 6:95514292-95514314 CAGCACACCTTGCCTCACTGTGG - Intergenic
1012897483 6:104967054-104967076 CACCATGCCTGGCCTCACTCTGG + Intronic
1014446647 6:121535698-121535720 CACCATCACTTTCCTAACTCAGG - Intergenic
1016531148 6:145059289-145059311 CACCTTGACTTCTCTGACTGGGG - Intergenic
1016910755 6:149196364-149196386 CATCAAGCCTTGCCTCAGTGGGG - Intergenic
1019174235 6:170152056-170152078 GACCACGACTTTCCGCACTGAGG + Intergenic
1019443594 7:1059743-1059765 CACTAAGACCTGCCTCACTACGG - Intronic
1020259202 7:6521257-6521279 CACCATGCCCAGCCTCACTGGGG + Intronic
1021690291 7:23224291-23224313 CACCATGCCTGACCTCACTCAGG + Intergenic
1022183806 7:27947731-27947753 CACCATCCCCTTCCTCACTGTGG + Intronic
1025275725 7:57580239-57580261 CACCATGGCTCGCCTCGCTGTGG + Intergenic
1025748531 7:64269755-64269777 CACCATGCCTTGCCTGCCAGCGG + Intergenic
1028289719 7:89049721-89049743 CACCATGCCTGGCCAGACTGTGG - Intronic
1029068434 7:97875425-97875447 CACCATGCCTGGCCACAGTGAGG + Intergenic
1031669790 7:124528705-124528727 CACTAGGTCATGCCTCACTGGGG + Intergenic
1035284198 7:157795851-157795873 CACCCTGACCTGCCTGACGGAGG + Intronic
1036250755 8:7160581-7160603 CACCATGTCTGGCCACAGTGAGG + Intergenic
1036366735 8:8126876-8126898 CACCATGTCTGGCCACAGTGAGG - Intergenic
1036884150 8:12538786-12538808 CACCATGCCTGGCCACAGTGAGG + Intergenic
1036978619 8:13443369-13443391 CACCATGCCTGGCCTCATTTGGG - Intronic
1037742337 8:21617472-21617494 CACCGTGCCCAGCCTCACTGGGG + Intergenic
1040367948 8:46738866-46738888 CACCATGCCTGGCCTCAGTTGGG + Intergenic
1042170803 8:65989279-65989301 CACCCTGCATTGCATCACTGTGG - Intergenic
1043613286 8:82092568-82092590 CACCATGCCTGGCCTGAATGGGG - Intergenic
1044375759 8:91468425-91468447 GATCTTGACCTGCCTCACTGTGG - Intergenic
1045285022 8:100783152-100783174 CACCATGCCTGGCCTCACAATGG - Intergenic
1045468692 8:102491831-102491853 CACCATGGCTGGCCTTTCTGGGG + Intergenic
1045912995 8:107432374-107432396 CACCGTGCCCAGCCTCACTGAGG - Intronic
1046628910 8:116604168-116604190 CACCTTGACTTTCCTCAGTGTGG - Intergenic
1048978913 8:139692651-139692673 CATCATGACCAGACTCACTGGGG + Intronic
1049965762 9:777744-777766 CACCATGCCTGGTCTCACTGGGG - Intergenic
1052046158 9:23796587-23796609 ATGCATGACTTGCCTCACTAGGG + Intronic
1057047534 9:91897814-91897836 CACCAAGACTTCCCTCCCTGAGG + Intronic
1060098197 9:120812763-120812785 CACCACCACTGTCCTCACTGGGG + Intergenic
1060496505 9:124123228-124123250 CACCCTCTCTTGCCTCACAGTGG - Intergenic
1061023635 9:128033281-128033303 CACCATGTCTGGCCTCATTGTGG + Intergenic
1061829883 9:133284998-133285020 CACCGTGCCTGGCCCCACTGAGG - Intergenic
1203621440 Un_KI270749v1:132722-132744 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1203626925 Un_KI270750v1:33731-33753 CACCATGGCTCGCCTCGCTGTGG + Intergenic
1186961071 X:14736866-14736888 CACCATGCCTGGCCTCACAATGG - Intergenic
1187587459 X:20679269-20679291 CACCATGCCTGGCCTCAATTGGG + Intergenic
1190143990 X:47873954-47873976 CACCATGCCTGGCCTTACAGTGG + Intronic
1195631252 X:107058003-107058025 CACCACGCCTGGCCTCAGTGTGG - Intergenic
1199755943 X:150865207-150865229 CACCATGCCTGGCCTTACTTTGG - Intronic
1200239920 X:154488064-154488086 CTCCATGACTTTCCTCTCTACGG - Exonic
1200983098 Y:9279912-9279934 CTCCATGTCCTTCCTCACTGTGG - Intergenic
1201189487 Y:11435313-11435335 CCCACTGGCTTGCCTCACTGTGG + Intergenic
1201189718 Y:11436308-11436330 CACCACGACTCGCCTCGCTGCGG + Intergenic
1202583927 Y:26405661-26405683 CACCACGACTTGCCTTGCCGCGG - Intergenic
1202584156 Y:26406658-26406680 CCCACTGGCTTGCCTCACTGTGG - Intergenic