ID: 1180548981

View in Genome Browser
Species Human (GRCh38)
Location 22:16527043-16527065
Sequence ACCATGACTTGCCTCACTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 8, 2: 2, 3: 22, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180548978_1180548981 -8 Left 1180548978 22:16527028-16527050 CCTAGAGCCTGCGACACCATGAC No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548977_1180548981 11 Left 1180548977 22:16527009-16527031 CCAGGAGGAGGAAGAGACACCTA 0: 1
1: 30
2: 15
3: 23
4: 271
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548969_1180548981 30 Left 1180548969 22:16526990-16527012 CCCGCCCAGCTGCTCCGTGCCAG No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548974_1180548981 25 Left 1180548974 22:16526995-16527017 CCAGCTGCTCCGTGCCAGGAGGA No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548976_1180548981 16 Left 1180548976 22:16527004-16527026 CCGTGCCAGGAGGAGGAAGAGAC 0: 1
1: 32
2: 10
3: 45
4: 395
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548970_1180548981 29 Left 1180548970 22:16526991-16527013 CCGCCCAGCTGCTCCGTGCCAGG No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140
1180548972_1180548981 26 Left 1180548972 22:16526994-16527016 CCCAGCTGCTCCGTGCCAGGAGG No data
Right 1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG 0: 1
1: 8
2: 2
3: 22
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180548981 Original CRISPR ACCATGACTTGCCTCACTGC GGG Intergenic
901849658 1:12007392-12007414 CCCATGACTGGCCTCAAAGCTGG - Intronic
913958785 1:143323835-143323857 ACCATGGCTCGCCTCGCTGCGGG - Intergenic
914053102 1:144149215-144149237 ACCATGGCTCGCCTCGCTGCGGG - Intergenic
914126095 1:144817326-144817348 ACCATGGCTCGCCTCGCTGCGGG + Intergenic
915439134 1:155933750-155933772 CCCAGGACTTCCCCCACTGCTGG + Exonic
918874162 1:190017426-190017448 ACAATGACTTGCCTAAGAGCAGG + Intergenic
1064749343 10:18510550-18510572 ACCATGGCTTCCCAAACTGCTGG + Intronic
1065578574 10:27148894-27148916 ATAAAGACTTACCTCACTGCTGG + Exonic
1066758902 10:38736784-38736806 ACCACGACTCGCCTCGCTGCGGG + Intergenic
1066962735 10:42235984-42236006 ACCATGACTTGCCTCGCTGCGGG - Intergenic
1067232143 10:44419430-44419452 ACCATCACGTGGCTCACTGTGGG - Intergenic
1069421167 10:68247861-68247883 TCCATGGCCTGCCTCACTGTAGG + Intergenic
1069941763 10:71961558-71961580 ATGATTACTTGCCTCATTGCAGG - Intergenic
1070944066 10:80374177-80374199 ACCATGGGTTGCATCACTGGTGG - Intergenic
1073512329 10:104050570-104050592 ACCAGGGCCTGCCTCACTCCTGG - Intronic
1073845318 10:107547163-107547185 ACCATGACTCTCCTCTCAGCTGG + Intergenic
1077582510 11:3425621-3425643 ACCACGCCTGGCCTCACTGAAGG + Intergenic
1078883041 11:15472062-15472084 ATCATGACTTGCCTCTCACCAGG + Intergenic
1079471018 11:20777553-20777575 ACCAGAAATTGCCTCACTGATGG + Intronic
1082200342 11:49358857-49358879 ACCATTGCTTGCCTCAGGGCAGG + Intergenic
1084239420 11:67808444-67808466 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1084833010 11:71784405-71784427 ACCATGCCCGGCCTCACTGAAGG - Intergenic
1085749942 11:79153015-79153037 TCCATCACTTGCCTTACTGCGGG + Intronic
1086431466 11:86740797-86740819 ACCATGACTCATCGCACTGCAGG - Intergenic
1088748719 11:112825823-112825845 ACCAAGGCTTGCCTCTCTGTAGG + Intergenic
1091079971 11:132657319-132657341 ACCACTCCCTGCCTCACTGCAGG - Exonic
1091765062 12:3114559-3114581 ACCATGCCTGGCCAGACTGCAGG - Intronic
1092410105 12:8246066-8246088 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1094809312 12:34122432-34122454 ACGGTGGATTGCCTCACTGCTGG - Intergenic
1101057366 12:100932693-100932715 ACCATGATCTGCCTGCCTGCTGG + Intronic
1102905992 12:116675645-116675667 AGCAGGACTGGCCTCTCTGCAGG - Intergenic
1111662292 13:91226223-91226245 ACCATTACTTGCCCCGCTGTAGG - Intergenic
1114651266 14:24286079-24286101 ACCTTGACTTGCCTCAGTTGGGG + Intergenic
1114800284 14:25766654-25766676 ACCATGAATTGATACACTGCAGG - Intergenic
1119864747 14:77964143-77964165 ACCATGCCTGGCCTCAGTGTTGG + Intergenic
1120862311 14:89265938-89265960 AGCCAGACTTGCCTCACTGGTGG + Intronic
1121300031 14:92862799-92862821 ACCCTGCCTTGGCTCACTCCAGG + Intergenic
1122424265 14:101596596-101596618 TCCAGGCCCTGCCTCACTGCAGG + Intergenic
1122506595 14:102235564-102235586 ATGATTACTTGCCTCACTGCAGG + Intronic
1202902549 14_GL000194v1_random:51873-51895 ACCACCATCTGCCTCACTGCAGG + Intergenic
1202929622 14_KI270725v1_random:26355-26377 ACCATGGCTCGCCTCGCTGCAGG + Intergenic
1123442333 15:20301481-20301503 ACCACGGCTCGCCTCGCTGCGGG + Intergenic
1124658935 15:31529593-31529615 GCCTTGCCTTTCCTCACTGCAGG + Intronic
1124831700 15:33154975-33154997 ACCATCACATGCCTCACCACTGG - Exonic
1125349699 15:38754026-38754048 ACCATGACTTTTCTCATTGACGG - Intergenic
1128931275 15:71706865-71706887 ACCACGTCTTGCCTCAGTTCTGG - Intronic
1132905161 16:2278717-2278739 ACCCTGACATCTCTCACTGCTGG + Intronic
1133351090 16:5100859-5100881 ACCATGCCCGGCCTCACTGAAGG + Intergenic
1136718885 16:32304069-32304091 ACCATGGCTCGCCTCGCTGCAGG - Intergenic
1136723906 16:32342425-32342447 ACCACGACTTGCCTCACTGCGGG - Intergenic
1136727418 16:32371677-32371699 CCCATGATTTGCCTCTCTGTTGG - Intergenic
1136837258 16:33510333-33510355 ACCATGGCTCGCCTCGCTGCAGG - Intergenic
1136842234 16:33548469-33548491 ACCACGACTTGCCTCACTGCGGG - Intergenic
1136862072 16:33710473-33710495 ACCACGGCTCGCCTCCCTGCAGG + Intergenic
1138128763 16:54460641-54460663 AACATGACATGCATCACTGCAGG + Intergenic
1139335305 16:66227047-66227069 AACATGAGTTCCCTCCCTGCAGG + Intergenic
1140398199 16:74647535-74647557 ACCTTGACTTCCCACAGTGCTGG + Intronic
1140683385 16:77408657-77408679 ACCATGACTTCTGTCACTGAAGG - Intronic
1202999015 16_KI270728v1_random:146073-146095 CCCATGATTTGCCTCTCTGTTGG + Intergenic
1203002525 16_KI270728v1_random:175340-175362 ACCACGACTTGCCTCACTGCGGG + Intergenic
1203007546 16_KI270728v1_random:213702-213724 ACCATGGCTCGCCTCGCTGCAGG + Intergenic
1203123566 16_KI270728v1_random:1558656-1558678 ACCACGACTTGCCTCACTGCGGG + Intergenic
1203130613 16_KI270728v1_random:1682481-1682503 CCCATGATTTGCCTCTCTGTTGG + Intergenic
1203134130 16_KI270728v1_random:1711746-1711768 ACCACGACTTGCCTCACTGCGGG + Intergenic
1203147434 16_KI270728v1_random:1810612-1810634 ACCGTGGCTCGCCTCGCTGCAGG - Intergenic
1203152399 16_KI270728v1_random:1848766-1848788 ACCACGACTTGCCTCACTGCGGG - Intergenic
1144540032 17:16132256-16132278 AACATGACTTGCTTTACTGCAGG + Intronic
1146057257 17:29587730-29587752 AACAAGACTTTCCTCACTGTGGG - Intronic
1147756532 17:42772223-42772245 TCCCTGACTAGCCTCACTACCGG - Intergenic
1147780392 17:42936816-42936838 ACCTTGCCTTACCTAACTGCAGG + Intergenic
1154194855 18:12258123-12258145 ACCAAGAGCTGCGTCACTGCTGG - Intronic
1155067326 18:22279223-22279245 ACCATCTCTTGCCTCACTTTTGG + Intergenic
1155625461 18:27829301-27829323 ACCAAAACTTGCCTCATTGGAGG - Intergenic
1157818661 18:50749621-50749643 TCCATGACTTGCAGCACTACAGG + Intergenic
1158206713 18:55001061-55001083 ACTATGACTTGCCTCATTGTGGG + Intergenic
1163883313 19:19945756-19945778 ATGATTACTTGCCTCATTGCAGG + Intergenic
1167616208 19:50535678-50535700 GCCATGACTGGCAGCACTGCAGG + Intronic
1202692497 1_KI270712v1_random:101638-101660 ACCATGGCTCGCCTCGCTGCGGG - Intergenic
925154335 2:1638399-1638421 ACCAGGACTTTCCTCACACCCGG + Intronic
926211853 2:10877134-10877156 ACCATGCCTAGCCTGAGTGCTGG + Intergenic
933750491 2:85599814-85599836 ACCTTGAGGTGCCACACTGCAGG + Intronic
933953903 2:87352333-87352355 ACCATGGCTCGCCTCGCTGCGGG + Intergenic
934238103 2:90248576-90248598 ACCATGGCTCGCCTCACTGCGGG + Intergenic
934275095 2:91568157-91568179 ACCATGGCTCGCCTCGCTGCGGG - Intergenic
934318557 2:91949399-91949421 CCCATGATTTGCCTCTCTGTTGG + Intergenic
934322229 2:91981124-91981146 ACCATGACTCGCCTCACTGCGGG + Intergenic
934460517 2:94211915-94211937 ACCACGGCTCGCCTCGCTGCGGG + Intergenic
935943560 2:108266480-108266502 ACCATATCTTTCCTCAGTGCAGG - Intergenic
941658131 2:168166397-168166419 TCAATGGCTTGCATCACTGCAGG + Intronic
941755612 2:169182482-169182504 ACCCTCTGTTGCCTCACTGCAGG - Intronic
942664963 2:178307755-178307777 AGCATGACCTTCCTGACTGCTGG + Intronic
944417383 2:199492439-199492461 ACCTTGACTTCCCTAAGTGCTGG - Intergenic
944541866 2:200761747-200761769 ACCATGCCTTGCTTGACTGATGG - Intergenic
947601380 2:231452789-231452811 CCCTTGTCTTGCCTCACAGCAGG + Exonic
948948769 2:241235594-241235616 ACCATGACCATCCTCCCTGCAGG - Exonic
1168971466 20:1933835-1933857 GTCATGACTTGACTCACTGGAGG - Intronic
1168973037 20:1943954-1943976 ACCAGCTCTTGCCCCACTGCTGG - Intergenic
1169100553 20:2944329-2944351 ACCATGCCTGGCCCCTCTGCTGG + Intronic
1171369646 20:24653348-24653370 GCCATGTCTTGCCTCACACCTGG - Intronic
1174126939 20:48313392-48313414 ACCATGACTATCTTCAGTGCAGG - Intergenic
1176591644 21:8654954-8654976 ACCACGGCTCGCCTCGCTGCAGG + Intergenic
1176621915 21:9066640-9066662 ACCACCATCTGCCTCACTGCAGG + Intergenic
1178513418 21:33226545-33226567 ACCAAGAGTAGCCTCATTGCTGG + Intergenic
1180274492 22:10632066-10632088 ACCACGGCTCGCCTCGCTGCAGG + Intergenic
1180306741 22:11133072-11133094 CCCATGATTTGCCTCTCTGTTGG + Intergenic
1180545260 22:16495255-16495277 CCCATGATTTGCCTCTCTGTTGG + Intergenic
1180548981 22:16527043-16527065 ACCATGACTTGCCTCACTGCGGG + Intergenic
1181355726 22:22294840-22294862 ACCACGGCTTGCCTCGCTGCGGG - Intergenic
1183012365 22:34957315-34957337 ACCATGAATGGCCTTAATGCTGG + Intergenic
1184896083 22:47407466-47407488 AGCATTTCTTGCCTCACGGCCGG - Intergenic
951850556 3:27135085-27135107 ACCATGACTAGCATTACTGTAGG + Intronic
954279645 3:49567643-49567665 ACCATGAATTGCTTGACTACAGG - Intronic
955027819 3:55187552-55187574 ACTCTGACCTACCTCACTGCTGG + Intergenic
957653645 3:83041256-83041278 GCCATGCCTTTCCTCAGTGCAGG - Intergenic
958140920 3:89560950-89560972 ACGATGACTTGCAGAACTGCAGG - Intergenic
960992905 3:123323467-123323489 ACCAGGCCCTGCCTCCCTGCTGG + Intronic
961299478 3:125913465-125913487 ACCATGCCCGGCCTCACTGAAGG - Intergenic
961889015 3:130114578-130114600 ACCATGCCTGGCCTCACTGAAGG + Intergenic
965058234 3:163749366-163749388 AGCATGACTTCCCTCATTGCCGG - Intergenic
968998156 4:3958500-3958522 ACCATGCCCGGCCTCACTGAAGG + Intergenic
970025773 4:11622610-11622632 ACCATGTCCTGCCTCATTTCTGG + Intergenic
970174087 4:13320860-13320882 ACTATGACTTGCCTCAGAGAGGG + Intergenic
974883010 4:67782570-67782592 ACCATACCTGGCCTCACTGCAGG + Intergenic
974994668 4:69140073-69140095 ACCATGACTTCCCAAAGTGCTGG + Intronic
977225990 4:94392393-94392415 CCCTTCACTTGCCTTACTGCAGG - Intergenic
979525135 4:121708275-121708297 ACCATGACTGGCACCACTGATGG + Intergenic
979648900 4:123107189-123107211 ACCCTGACTTGCCACATTGAGGG - Intronic
979702688 4:123686253-123686275 ACCAAGACTATCCTCACTTCAGG - Intergenic
980999968 4:139819315-139819337 ACCATGTCTCTCATCACTGCAGG - Intronic
983096746 4:163571376-163571398 ACAATGACTGGCCACACGGCAGG + Intronic
988298171 5:29391799-29391821 ATGGTCACTTGCCTCACTGCGGG + Intergenic
997574825 5:134966658-134966680 ACCCTGAGTTGGCTAACTGCAGG - Exonic
1001130966 5:169063186-169063208 ACCATGACTGGCCTTAATGCCGG + Intronic
1001473955 5:172036096-172036118 ACCAGGACTTGCCTGACTGCAGG + Intergenic
1002192294 5:177484588-177484610 GCCATGGCTTACCTCACTTCAGG - Intronic
1002259483 5:177983851-177983873 TCCAAGACTGGCCTCACAGCAGG - Intergenic
1010888623 6:81275260-81275282 ACCCTGACTTGCCTGAGTTCTGG - Intergenic
1012785673 6:103622429-103622451 ATCATCACTGACCTCACTGCAGG + Intergenic
1012817951 6:104048257-104048279 AACATCTCTAGCCTCACTGCAGG + Intergenic
1018660977 6:166087335-166087357 CCCATGACTCCCCTGACTGCAGG + Intergenic
1019683332 7:2365557-2365579 GCCATGATTTACCTGACTGCTGG - Intronic
1020788097 7:12593705-12593727 ATGATTACTTGCCTCATTGCAGG - Intronic
1020978059 7:15032459-15032481 ACCCTGACTGGCCTCTTTGCCGG + Intergenic
1023639401 7:42242335-42242357 TACATAACTTGCCTCACTCCTGG + Intergenic
1027125816 7:75556014-75556036 TCCGTGACTTGCCTCTGTGCTGG + Exonic
1027622028 7:80500151-80500173 ACCTAGACCTGCCTCACTCCTGG + Intronic
1028349005 7:89819994-89820016 ACCCTGACTTTCCTCAGTTCTGG - Intergenic
1029128323 7:98310973-98310995 ACCATGACTGGCCACATTTCAGG + Intronic
1034203615 7:149297489-149297511 ACCATGACTCTTCTCAGTGCAGG + Intergenic
1039206910 8:35166355-35166377 ATCATGACTTCCCTCAGAGCTGG - Intergenic
1040499955 8:47997327-47997349 ATGATTACTTGCCTCATTGCAGG - Intergenic
1042835083 8:73072417-73072439 ACCATGGCCTCCCACACTGCTGG - Intronic
1042914134 8:73858069-73858091 ACCATGCCTTGCCTAACTTTTGG - Intronic
1043798584 8:84578418-84578440 CCCCTGACTTGCCACATTGCAGG - Intronic
1044536498 8:93362508-93362530 ACCATTACTTACCTCCCTGGAGG + Intergenic
1049632175 8:143664738-143664760 CCCATGACGAGCCTCAGTGCAGG - Intergenic
1052255824 9:26455362-26455384 ACCCAGAGTTGTCTCACTGCTGG + Intergenic
1059805398 9:117794113-117794135 ACACTGCCTTGCCTCACTACAGG - Intergenic
1203745101 Un_GL000218v1:37058-37080 ACCACCATCTGCCTCACTGCAGG + Intergenic
1203565009 Un_KI270744v1:82426-82448 ACCACCATCTGCCTCACTGCAGG - Intergenic
1203621671 Un_KI270749v1:133718-133740 ACCACGGCTCGCCTCGCTGCAGG + Intergenic
1186831900 X:13399185-13399207 ACCATGCCTGGCCTCACCTCTGG - Intergenic
1192177665 X:68895874-68895896 TCCATGACTAGTCTCATTGCTGG - Intergenic
1193698882 X:84740282-84740304 ATAATTACTTGCGTCACTGCAGG + Intergenic
1194520054 X:94908307-94908329 ACCCTGGCCTCCCTCACTGCTGG - Intergenic
1196755723 X:119155608-119155630 ACCATGACTCACCACACTCCTGG + Intergenic
1197967169 X:132077627-132077649 ACCTTGCCTTGCCACAGTGCTGG + Exonic
1201158435 Y:11152097-11152119 ACCACCATCTGCCTCACTGCAGG + Intergenic
1201186111 Y:11404478-11404500 CCCATGATTTGCCTCTCTGTTGG + Intergenic
1201189719 Y:11436309-11436331 ACCACGACTCGCCTCGCTGCGGG + Intergenic
1201755311 Y:17480723-17480745 ACAGTGGGTTGCCTCACTGCTGG - Intergenic
1201846241 Y:18425262-18425284 ACAGTGGGTTGCCTCACTGCTGG + Intergenic
1202583926 Y:26405660-26405682 ACCACGACTTGCCTTGCCGCGGG - Intergenic