ID: 1180559818

View in Genome Browser
Species Human (GRCh38)
Location 22:16607043-16607065
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180559814_1180559818 7 Left 1180559814 22:16607013-16607035 CCTTCCAAGGTGAAAATTGGTCA No data
Right 1180559818 22:16607043-16607065 GTTATAAAGGACATTAAGGATGG 0: 2
1: 0
2: 1
3: 13
4: 216
1180559815_1180559818 3 Left 1180559815 22:16607017-16607039 CCAAGGTGAAAATTGGTCAGTTT No data
Right 1180559818 22:16607043-16607065 GTTATAAAGGACATTAAGGATGG 0: 2
1: 0
2: 1
3: 13
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180559818 Original CRISPR GTTATAAAGGACATTAAGGA TGG Intergenic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
904206622 1:28859595-28859617 TTTATGAAGGAGATTATGGATGG + Intronic
905837402 1:41138533-41138555 GTAATAAGGGACATTAAGGAGGG - Intronic
905936045 1:41825240-41825262 GTTACAAAGTACATTCACGAGGG + Intronic
907755859 1:57310166-57310188 GTTATGAAGAAAAGTAAGGATGG + Intronic
908383138 1:63615429-63615451 GCTGTAAAGGACATGAAAGAAGG - Intronic
908516731 1:64900098-64900120 GTTATACAGGAAATTAGGGCTGG + Intronic
908984765 1:70004337-70004359 GTTAAAAAGAAAATTAAGAATGG + Intronic
911416584 1:97582423-97582445 GTTACCAAGGACATGAAGGAGGG + Intronic
912914914 1:113805012-113805034 GTTAAAAAGGAAAGAAAGGAAGG - Intronic
913585671 1:120272911-120272933 ATTATAAAGGACAATATGAACGG - Intergenic
913622513 1:120625455-120625477 ATTATAAAGGACAATATGAACGG + Intergenic
914258181 1:145977376-145977398 GTTTTAAAGGAGAGGAAGGAAGG - Intronic
914685102 1:149971378-149971400 GTTATAAAGAAAATTAAAGCAGG - Intronic
917435201 1:175014096-175014118 GTTTTAAAGTCCCTTAAGGATGG + Exonic
918385148 1:183998726-183998748 TTTATTAAAAACATTAAGGAAGG - Intronic
918689490 1:187463154-187463176 AATATAAAGGACATCAGGGAGGG + Intergenic
918894659 1:190326046-190326068 GTAATCCAGGAAATTAAGGAAGG + Intronic
919249707 1:195037533-195037555 CTTTTAAAGGACATTAAACAGGG - Intergenic
919399449 1:197093208-197093230 ATTATAGAGGATATAAAGGAAGG - Exonic
919953442 1:202388539-202388561 ATTATAAAGAACATGAAAGAAGG + Intronic
920173443 1:204085586-204085608 TTTATAAAGGACATCTAGGCTGG + Intronic
921410340 1:214829732-214829754 CTTATAAAAGAGATTGAGGAGGG - Intergenic
921875198 1:220187776-220187798 ATTATAAAGGATATTACAGAGGG - Intronic
922098777 1:222465209-222465231 CTTCTAAAGCACGTTAAGGATGG - Intergenic
923082666 1:230673414-230673436 GTTATAAAGCTCATGAAGGGTGG - Intronic
923449929 1:234106927-234106949 TTTATAAATGACAAGAAGGATGG - Intronic
923827183 1:237513288-237513310 GTTCTGTAGGACATCAAGGATGG - Intronic
1063627977 10:7708512-7708534 GTAATAGAGGAGATTAAAGAAGG + Intronic
1065136642 10:22677345-22677367 GTTTTAAAGGAAAGAAAGGAGGG + Intronic
1065783235 10:29190087-29190109 CTTATAAAGGACATTTTGGGAGG - Intergenic
1067682211 10:48448331-48448353 GTTAAAAGGGAGATGAAGGAGGG - Intronic
1067958876 10:50825093-50825115 GCTCTGAAGGACATTCAGGAAGG - Intronic
1068304929 10:55196060-55196082 GTCATTAAGAACAGTAAGGAAGG - Intronic
1070994826 10:80768901-80768923 GTTACAAAGGACAATATTGAAGG - Intergenic
1071403571 10:85304497-85304519 GTTATATGGGACAATCAGGAAGG - Intergenic
1071934496 10:90512816-90512838 CTTATAAAAGAGATTAAAGAGGG + Intergenic
1072348486 10:94533040-94533062 GTAATGAAGGATATTAAAGAAGG + Exonic
1072714632 10:97742293-97742315 CTGATAAAGGACATTTAGTAGGG - Intronic
1072745627 10:97937285-97937307 GGTTTAAAGGAGATGAAGGAGGG - Intronic
1072816473 10:98514363-98514385 GTTATGAAGTACATTCACGATGG - Intronic
1072994799 10:100233329-100233351 CTTATCAGGAACATTAAGGATGG + Exonic
1074985700 10:118657988-118658010 GTTATTAAGCTAATTAAGGAGGG - Intergenic
1076253649 10:129002913-129002935 TTTAGAAAGGAAATTAAGTAAGG - Intergenic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1079722270 11:23832136-23832158 TTTATAAAGGACAATATGAATGG + Intergenic
1080977033 11:37355764-37355786 GTTCTATAGTACATTAAGAAAGG + Intergenic
1082567568 11:54699616-54699638 GTTATTAAGCAAATTAGGGAGGG - Intergenic
1082612894 11:55323547-55323569 GTTGTTCAGGAAATTAAGGATGG + Intergenic
1084055860 11:66632371-66632393 ATTTTCAAAGACATTAAGGAAGG + Intronic
1084644827 11:70450088-70450110 GCTATCAAGGACATTAAGTGAGG - Intergenic
1085939327 11:81189721-81189743 GTTATGAGGCACATTCAGGAGGG + Intergenic
1086821831 11:91445203-91445225 GTTATAAATTACTGTAAGGATGG + Intergenic
1087199546 11:95331835-95331857 CTTAGAAGGGACATTAGGGAGGG + Intergenic
1087339669 11:96887655-96887677 GTTATAAAGGAGATACAGGGAGG - Intergenic
1087500230 11:98942565-98942587 GTAATACAGGGCTTTAAGGATGG + Intergenic
1092129335 12:6097873-6097895 CTAATAAACCACATTAAGGAAGG + Intronic
1092136071 12:6148105-6148127 GTTGGAAAGGACTTTAGGGAAGG + Intergenic
1092584345 12:9881253-9881275 ATTATAAAAGACATGAAGGAAGG + Intergenic
1094093870 12:26681526-26681548 GTTCTAAAGGACCTAAAGGAAGG - Intronic
1098444107 12:70548597-70548619 GATAAAAAGGACCTTTAGGAAGG + Intronic
1099770681 12:87050074-87050096 TTTATAAAGTAACTTAAGGATGG + Intergenic
1099915852 12:88892161-88892183 GTGATAAAGGATATTAAGCGAGG - Intergenic
1102995588 12:117347582-117347604 GTTTTAAAGGGCAACAAGGAAGG + Intronic
1103257942 12:119558947-119558969 GTTAGAAAAGTCATCAAGGAAGG + Intergenic
1104470264 12:129024591-129024613 GTTATAAAGCAAAATAAGTAAGG - Intergenic
1106595388 13:31131056-31131078 GTTGTAAAGGACATTTTTGATGG + Intergenic
1107755876 13:43622197-43622219 GTTATAAAGCTAATTAGGGAGGG - Intronic
1110028608 13:70575026-70575048 GTTATGAAGAAAATTGAGGATGG + Intergenic
1111169442 13:84506365-84506387 GTTATAGAGCACCTAAAGGAAGG - Intergenic
1111255097 13:85657275-85657297 GATATAAGGAACTTTAAGGAAGG + Intergenic
1115278020 14:31630193-31630215 GTTATCATGGACATTAGAGATGG + Intronic
1116391460 14:44396228-44396250 GTGATAAAGGAAATAAAGGAAGG - Intergenic
1116586087 14:46706602-46706624 GGTATAAAGTACCTTAAGCAAGG + Intergenic
1117522309 14:56562998-56563020 GTAAGAAAGGACAAAAAGGAAGG + Intronic
1118161122 14:63291404-63291426 TTTATAAAAGACATCAAGTAAGG - Exonic
1118460897 14:65986100-65986122 GTCATAAAAGACCTTAAGTACGG + Intronic
1119110372 14:71967821-71967843 CTTTTAAATGACATTTAGGATGG + Intronic
1119496772 14:75086335-75086357 GTTATAAAGGACATTTTTGTGGG + Intronic
1121441835 14:93954448-93954470 TTGATAAAGGCCATCAAGGATGG - Exonic
1124867833 15:33510821-33510843 ATGACAAAGGACAGTAAGGAGGG - Intronic
1124947490 15:34283402-34283424 GTTATAAAGAAAATAAAGAAGGG + Intronic
1125697194 15:41649085-41649107 GTTAAAAAGGACATACAGGCTGG + Intronic
1127337731 15:58006183-58006205 GTTATAATGGACTTTGGGGAAGG - Intronic
1130475006 15:84257216-84257238 ATTATAAATAACATTTAGGAAGG - Intergenic
1130482421 15:84371269-84371291 ATTATAAATAACATTTAGGAAGG - Intergenic
1131140451 15:89972795-89972817 GTTGGAAAGGACATTAGGCAGGG - Intergenic
1132824216 16:1895121-1895143 TTTATAAAGGCCATAAAGGTAGG + Intergenic
1132948487 16:2546628-2546650 GTTAGAAGGGCCACTAAGGAAGG - Intronic
1134318561 16:13141898-13141920 GTTATTACAGACATAAAGGATGG - Intronic
1136676945 16:31919091-31919113 GTTATATAGGTTATTAAGAATGG + Intergenic
1141360294 16:83389496-83389518 TTTATAAAAAACATAAAGGATGG - Intronic
1142492990 17:290508-290530 GATAAGAAGGACATTGAGGAAGG - Intronic
1142692519 17:1615437-1615459 ATTATAAAGCACATTAAGAATGG + Intronic
1145752994 17:27368513-27368535 GAGATGAAGGACATGAAGGAGGG - Intergenic
1146309984 17:31760592-31760614 CTTATAAAGGACATTGACGCTGG - Intergenic
1148641286 17:49189674-49189696 GTTAGGAAGGACCTGAAGGAAGG - Intergenic
1149266520 17:54933305-54933327 GTCATAAAGGTCATTAAAGGTGG - Intronic
1153237089 18:2998567-2998589 ATTATAAAGGAAATAAAAGAGGG + Intronic
1156799756 18:41095766-41095788 GTTGTATAGGACATTGGGGATGG + Intergenic
1156852829 18:41747885-41747907 TTTTTAAAGTACATTAAGGATGG - Intergenic
1159874549 18:73795927-73795949 GTTATAAAGGTCAATAAAGGAGG - Intergenic
1165302670 19:34980916-34980938 GTTATAAAGTAAATAAAGGCTGG - Intergenic
1168625998 19:57918407-57918429 CTTATAAAGAACAATAAGGCTGG + Intergenic
925664611 2:6239296-6239318 GTTATAAAGGTCACTAAAAAGGG - Intergenic
926578687 2:14611017-14611039 ATTGTAAAGGATATTAAGAAGGG - Intergenic
932034857 2:68234045-68234067 GTTATAAAGAAGCTTAAGGCCGG + Intronic
933076520 2:77934309-77934331 TTGCTAAAGGAAATTAAGGAAGG + Intergenic
934892724 2:98084904-98084926 GTGATAAAGGAAATGAAGGGAGG - Intergenic
937546096 2:123022768-123022790 GTAGAAAAGGACATTAATGATGG - Intergenic
937559248 2:123200983-123201005 TATATAAAGTACATTAAGGTTGG - Intergenic
937892847 2:126952623-126952645 TTGAGAAAGGCCATTAAGGAAGG - Intergenic
939614131 2:144343583-144343605 TTTATAAAGGACATTTAGTAAGG + Intergenic
940196245 2:151097395-151097417 GTTATAATGCATGTTAAGGAGGG + Intergenic
940589003 2:155696955-155696977 GTGATAAAGGCTATTAATGATGG - Intergenic
941420817 2:165281249-165281271 GTTATAGAGGGAAATAAGGAAGG + Intronic
942116238 2:172731855-172731877 GCTATAAAGGATATGAGGGATGG - Intergenic
943492823 2:188577920-188577942 ATTATAAATAACATTAAAGATGG - Intronic
944548009 2:200817200-200817222 ATTATAAAGGCTATTAAGAATGG - Exonic
944896998 2:204175441-204175463 GTTATAAAAGAAAATATGGATGG + Intergenic
945093755 2:206200113-206200135 CTTCTAAAGGCCATTAAGAATGG + Intronic
947522273 2:230856373-230856395 TTTATAAACGATATAAAGGAAGG - Intergenic
1169462157 20:5805123-5805145 TTGATAAAGAAGATTAAGGAGGG - Intronic
1169639315 20:7732306-7732328 TTTATAGAAGACATGAAGGATGG + Intergenic
1170722161 20:18891279-18891301 GGTATAAAGGACAGGAGGGAGGG + Intergenic
1172456824 20:35082565-35082587 GTTATAATGGTCAGTAAGCATGG - Intronic
1174175400 20:48641484-48641506 GGTTTAAAAGACATGAAGGAAGG + Intronic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1176932646 21:14831454-14831476 GATATAAAGGAAATAAAGGCAGG - Intergenic
1177782181 21:25633470-25633492 GTTATAAAATACCTGAAGGAAGG + Intergenic
1179814780 21:43898486-43898508 GTTGTAAGGGGCATTAACGAAGG - Intronic
1180559818 22:16607043-16607065 GTTATAAAGGACATTAAGGATGG + Intergenic
1180681612 22:17630943-17630965 GTTATAAAGGTTATAAAGTAAGG - Intronic
1181476627 22:23172007-23172029 GATATAAAATGCATTAAGGAAGG - Intergenic
1181713645 22:24707733-24707755 GTTAGAGAGGACAGTCAGGAGGG - Intergenic
1181874133 22:25926606-25926628 TGTATAAAGGACATGTAGGAGGG + Intronic
1182879970 22:33724899-33724921 GTTGTGAAGGAAATAAAGGAAGG + Intronic
1183224675 22:36541448-36541470 GTTATAAAGCACATTGAGGCCGG + Intergenic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
949308019 3:2665128-2665150 CATATAAAGGTCTTTAAGGAGGG - Intronic
950358385 3:12430985-12431007 GTCATGAAGGACATTAAAGGTGG + Intronic
951228853 3:20152941-20152963 ATTCTGAAGGACTTTAAGGAAGG + Exonic
954975308 3:54688409-54688431 GTTATGAAGGACAGGAAGGAAGG + Intronic
955367810 3:58326567-58326589 GTTATAAAGGAAATCACGGTCGG - Intergenic
956480629 3:69670317-69670339 GTTATAAAGAAAATAAAGAAGGG - Intergenic
957766963 3:84637898-84637920 ATAATAAAGGATAGTAAGGAGGG - Intergenic
959925700 3:111919430-111919452 TTCATAAAGTACATTAAAGAGGG - Intronic
960355405 3:116646638-116646660 ATTATAAAGGCTATTAAGAATGG + Intronic
960692879 3:120365577-120365599 TTTATAAAGTAAATTAGGGAGGG + Intergenic
961195354 3:124996832-124996854 GATATAAAGGCCATCATGGATGG - Intronic
962711471 3:138090224-138090246 GTTAAAAAGGATATCATGGATGG + Intronic
963351187 3:144153418-144153440 TTTCTAAAGGAAATTAAAGAAGG + Intergenic
963734767 3:149007361-149007383 GTTCTAAAGGACAATAAAGATGG - Intronic
964909489 3:161761391-161761413 GTTATTAATGACATTTAGAATGG - Intergenic
965794565 3:172426577-172426599 ATTATAAAGGCTATTAAGAATGG + Intergenic
966158334 3:176942536-176942558 GTTAAAAAGGACATAATAGAGGG + Intergenic
972373912 4:38452488-38452510 GGTATAAAGAGCATTAAGTAAGG + Intergenic
973896088 4:55414614-55414636 GATATAAAGGACATTATTGAGGG - Intronic
976114108 4:81708555-81708577 TTGATAAAGGAAATGAAGGAAGG + Intronic
976287194 4:83382088-83382110 GTTATAAAGCTCATGAAGGTTGG - Intergenic
976524276 4:86068682-86068704 TTTAGAAAGTACATTAAGCATGG + Intronic
981433314 4:144688315-144688337 ATTATAAAGGAAGTTAAGCATGG + Intronic
983901724 4:173142768-173142790 GTTATTGAGGATATTAAGCAAGG - Intergenic
986308253 5:6531656-6531678 GTGATAAGGGACATGAAGAAAGG + Intergenic
987263807 5:16230146-16230168 GTGAAAAAGGAGATAAAGGAAGG + Intergenic
987800030 5:22683658-22683680 GATATAAAGGAAAGAAAGGAGGG - Intronic
987808447 5:22801975-22801997 AGTATAAGGGATATTAAGGATGG - Intronic
988172486 5:27677358-27677380 GTTATAAAAGCCATTTATGATGG + Intergenic
990747074 5:58969275-58969297 GTTATAAAGAAAATTGAGCAGGG + Exonic
990930531 5:61085397-61085419 CTGATAAAGGGCATTAAGGGGGG + Intronic
991650328 5:68846102-68846124 GTCATAAATGCCATGAAGGAAGG + Intergenic
992129255 5:73674948-73674970 ATTATAAAGGATATTACGAAGGG - Intronic
993376725 5:87157328-87157350 GTTATATAGGATACTAAAGATGG - Intergenic
993514099 5:88808074-88808096 GTCATAATTGATATTAAGGATGG + Intronic
995332922 5:110965734-110965756 TATATAAAGGACCTGAAGGAAGG - Intergenic
995664049 5:114521464-114521486 ATTAGAAAAGACATTTAGGAGGG + Intergenic
995927425 5:117391508-117391530 GAAATAAAGGACATAGAGGATGG + Intergenic
997814679 5:137004660-137004682 TTTATATATGACATTCAGGAGGG - Intronic
998865329 5:146494173-146494195 GTTATAAAAGACATTTTGGGGGG + Intronic
1000301812 5:159963531-159963553 GTTGTAAAGGACAGTATGAATGG + Intronic
1002399277 5:178982279-178982301 GTTATAAAGCACATGAAGCCTGG + Intronic
1004493113 6:16136387-16136409 GATATATAGGACAATATGGATGG - Intronic
1004648713 6:17588081-17588103 GTTATAAAGGGCTTTAACGAGGG - Intergenic
1007717228 6:43864330-43864352 CTCCTCAAGGACATTAAGGAAGG - Intergenic
1009953909 6:70429061-70429083 GTTAGAAAAGGCATTATGGAGGG + Intronic
1013492719 6:110664927-110664949 GAAATAAAGGCCATTAAGGCAGG + Intronic
1015532646 6:134236334-134236356 GTTTTAAAAAACATTAAGGGAGG + Intronic
1016698399 6:147025577-147025599 TTTATAAAGGGCAGTAAGCATGG - Intergenic
1017476158 6:154795503-154795525 GTGATTAATGACATTAAGAAAGG + Intronic
1018020150 6:159754985-159755007 GTTATAAACGATATTAAAGTTGG + Intronic
1019532365 7:1510247-1510269 TTTTTAAAAGACATGAAGGAAGG - Intergenic
1022783669 7:33613346-33613368 GTTATAAAAGACGTTAATCAAGG - Intergenic
1023465117 7:40445983-40446005 GTTTTAAAGGATATTAACAAGGG + Intronic
1025858478 7:65304976-65304998 ATTCTAAAGGACATTAGGTAGGG + Intergenic
1027776185 7:82467417-82467439 GTTATAAAGAAGAGAAAGGAAGG - Intergenic
1027857945 7:83536947-83536969 GTAATTAAGGTCATTAAGGTGGG + Intronic
1031659181 7:124399001-124399023 GTGATTAAGGACCTTAAGGTAGG - Intergenic
1033659508 7:143393842-143393864 GTTATGAAGAGCATTGAGGATGG - Exonic
1034590736 7:152136947-152136969 GTAAGAAAGGACAGCAAGGAAGG + Intronic
1034617428 7:152430828-152430850 GTTATAAAGGACATTAAGGATGG - Intronic
1036005784 8:4661854-4661876 GTTATCATGGAGATGAAGGACGG + Intronic
1036507761 8:9370990-9371012 GTTAAGAAGGACATGAAGGTGGG - Intergenic
1038366093 8:26936909-26936931 GAAATAAAGGACATTAAAGTAGG - Intergenic
1044259791 8:90105020-90105042 TTGATAAAAGAAATTAAGGAAGG - Intergenic
1045640539 8:104245684-104245706 GCTGTAAAGGACATTAACAAAGG + Intronic
1045733559 8:105268388-105268410 GCTATAGCAGACATTAAGGAGGG - Intronic
1047798875 8:128288178-128288200 GTGATAAATGTCATAAAGGAAGG + Intergenic
1050244898 9:3678633-3678655 GTTATAAAAATCATTAAGAATGG - Intergenic
1051594111 9:18806861-18806883 GATGTGAAGGCCATTAAGGAAGG - Intronic
1052762108 9:32603188-32603210 GGTAAAAATAACATTAAGGATGG + Intergenic
1057006501 9:91565538-91565560 ATTATAAATGATATTAAGGCCGG + Intronic
1058404083 9:104652141-104652163 GAAATTAAGGACATTAAGCAAGG + Intergenic
1060712297 9:125879649-125879671 GATTAAAAGGACATTAAGAAAGG + Intronic
1185843708 X:3417253-3417275 GCTATAGAGGAAATGAAGGAAGG - Intergenic
1186651778 X:11569060-11569082 GTTATACAGGAAAACAAGGAAGG + Intronic
1188046678 X:25433149-25433171 GTTATGAAGGAAATAAAAGAGGG + Intergenic
1190114636 X:47618776-47618798 GTTTAAAAGGGCTTTAAGGACGG + Intronic
1190265367 X:48824715-48824737 GTTGCAAAGGATATTCAGGATGG - Exonic
1192019198 X:67366797-67366819 TTTATAAAGGACATTTTTGATGG + Intergenic
1192390797 X:70726385-70726407 GTTTTAAGAGACAATAAGGATGG - Intronic
1192975835 X:76284161-76284183 GATATAAAGGACATTCACAATGG - Intergenic
1194823828 X:98537392-98537414 GATATAAAGGACATTTGTGATGG + Intergenic
1195001386 X:100646518-100646540 GTATTAAAGGACAATAAAGATGG + Intronic
1195635869 X:107115356-107115378 GTAATAAAGAGCCTTAAGGAAGG + Exonic
1196259993 X:113567390-113567412 GTTATGAAGGAAAATAAGCATGG + Intergenic
1197119619 X:122875008-122875030 TTTAAAAAGGACATTGGGGAGGG - Intergenic
1197419126 X:126216216-126216238 GTTTTAAAGAAAATTGAGGATGG + Intergenic
1198527871 X:137520311-137520333 GTCATGAAGGACATTCAGGTTGG - Intergenic
1198698228 X:139366866-139366888 GTATTAAAGGACATTTTGGAGGG + Intergenic
1201977085 Y:19862908-19862930 GCTATAAGGGACACTAAGGAGGG + Intergenic
1202375984 Y:24237646-24237668 ATTATAAATAACATTTAGGAAGG + Intergenic
1202494796 Y:25432472-25432494 ATTATAAATAACATTTAGGAAGG - Intergenic