ID: 1180568839

View in Genome Browser
Species Human (GRCh38)
Location 22:16697546-16697568
Sequence CAATGAGGCGGATCTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180568830_1180568839 22 Left 1180568830 22:16697501-16697523 CCACACCGCTCAGCACGAAGGCC 0: 1
1: 1
2: 2
3: 7
4: 105
Right 1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG 0: 1
1: 1
2: 0
3: 3
4: 69
1180568831_1180568839 17 Left 1180568831 22:16697506-16697528 CCGCTCAGCACGAAGGCCTTGTT 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG 0: 1
1: 1
2: 0
3: 3
4: 69
1180568835_1180568839 1 Left 1180568835 22:16697522-16697544 CCTTGTTCTCAGGGGCCTGCTTC No data
Right 1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG 0: 1
1: 1
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180568839 Original CRISPR CAATGAGGCGGATCTGCTTG AGG Intergenic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900750922 1:4396934-4396956 CATTGAGGCAGCTCTGCTTTAGG - Intergenic
900787789 1:4659600-4659622 CTCTGAGGCGGATGTACTTGGGG - Intronic
918825361 1:189316752-189316774 CACAGAGGCGGATCTGACTGCGG + Intergenic
1063313037 10:4973388-4973410 CAGTGAGGCAGCTCTGCTTCAGG + Intronic
1063313882 10:4983145-4983167 CAGTGAGGCAGCTCTGCTTCAGG - Exonic
1063314956 10:4994660-4994682 CAGTGAGGCAGCTCTGCTTCAGG - Intronic
1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG + Intronic
1069524380 10:69154628-69154650 CAATGTGGCAGAACTGCTTGAGG + Intronic
1070787391 10:79169886-79169908 CAAACAGGAGCATCTGCTTGAGG + Intronic
1078323164 11:10355215-10355237 GAATGAGGGGGATGTGGTTGGGG - Intronic
1080188690 11:29521179-29521201 GAAAAAGGCTGATCTGCTTGTGG + Intergenic
1090599886 11:128359057-128359079 CAATAAAGCAGGTCTGCTTGAGG + Intergenic
1092117400 12:6019133-6019155 CGATGAGGCGGATCTGCTTGAGG + Exonic
1098989077 12:77044960-77044982 AAATGAGGCAGATTTTCTTGTGG + Intronic
1100030983 12:90190614-90190636 CCATGAGGGGGTCCTGCTTGTGG + Intergenic
1102235110 12:111289597-111289619 TAAGGAAGCGGATGTGCTTGCGG + Intronic
1112261246 13:97880307-97880329 CAATGAGGCGTATTTGCAAGTGG - Intergenic
1122355880 14:101122605-101122627 CAAGGAGGCAGAGCTGCTAGAGG - Intergenic
1130957291 15:88636764-88636786 GGCTGAGGCGGATTTGCTTGAGG - Intronic
1140060779 16:71567961-71567983 GAATGAGGAGGATCTGAGTGTGG + Exonic
1143114390 17:4574273-4574295 CATTTCTGCGGATCTGCTTGTGG - Intergenic
1144862762 17:18315852-18315874 CAATGAGCCGGCCCTGCCTGAGG + Exonic
1147981014 17:44274007-44274029 CTGGGAGGAGGATCTGCTTGAGG + Intergenic
1151096572 17:71505955-71505977 AAATGAGGCTGATGTGATTGTGG + Intergenic
1158871910 18:61696374-61696396 CAATGTGGGGGATCTGGGTGAGG + Intergenic
1162378439 19:10318231-10318253 TACTGAGGTGGCTCTGCTTGAGG + Exonic
1162825413 19:13248341-13248363 CAAGGAGGGAGAACTGCTTGAGG + Intronic
1168313532 19:55473531-55473553 CAAGGAGGCTGATCTAGTTGGGG + Intergenic
928039286 2:27858214-27858236 GAATGAGGAGGAACTGCTTAAGG + Intronic
940582079 2:155594191-155594213 TTATCAGGCAGATCTGCTTGAGG - Intergenic
1170366814 20:15607081-15607103 CAAGGAGGGAGAACTGCTTGAGG + Intronic
1178266822 21:31151098-31151120 CAATGAGGAGGAACTGCTGGAGG + Intronic
1179966410 21:44809089-44809111 CAATGAGGCAGATCAGATTCAGG - Exonic
1180568839 22:16697546-16697568 CAATGAGGCGGATCTGCTTGAGG + Intergenic
1183837572 22:40468730-40468752 TAATGAGGTGTATATGCTTGAGG + Intronic
954672304 3:52297639-52297661 CCATGAGGCGGAGCTGCTAAGGG - Intergenic
955453273 3:59093469-59093491 CAAAGAGGAGGTCCTGCTTGAGG - Intergenic
958584819 3:96072932-96072954 CAAGGAGACTGATCAGCTTGAGG - Intergenic
965373066 3:167888973-167888995 CAATGAAGCAGAAATGCTTGGGG - Intergenic
969371284 4:6733090-6733112 CAGAGAGGCTGACCTGCTTGGGG + Intergenic
985691547 5:1315508-1315530 CCATGAGATGGATCTGCATGAGG + Intergenic
992249602 5:74864699-74864721 TAATGATGGGGATCTGTTTGGGG - Intronic
992481370 5:77155311-77155333 CTATGGGGCGGACCTGCCTGCGG - Intergenic
997197211 5:131988122-131988144 CCATGAGGATGATCAGCTTGAGG + Exonic
997616632 5:135250925-135250947 CAATGAGGCGGCTCTTCATAGGG + Intronic
998166919 5:139849432-139849454 CCATGAGGTGTCTCTGCTTGTGG + Intronic
998369347 5:141651027-141651049 GAGGGAGGCGGATCTGCTGGAGG - Exonic
1003479660 6:6519367-6519389 GAAAGAGGAGGATCTACTTGTGG - Intergenic
1003682031 6:8266090-8266112 CAGTGAGGCCGATCGGCTAGAGG + Intergenic
1006707326 6:36032012-36032034 CAAGGTGGGGGAACTGCTTGAGG - Intronic
1006877815 6:37313941-37313963 TTATGAGGCGGTTGTGCTTGTGG + Intronic
1018000326 6:159572918-159572940 CACTGAGGCCCTTCTGCTTGAGG - Intergenic
1019765040 7:2843921-2843943 GGATGATGCGCATCTGCTTGAGG + Exonic
1021118763 7:16773263-16773285 CAATGAGATGGATCTGGCTGTGG - Intronic
1022710486 7:32844784-32844806 CAATGAGGTTAATCTGCCTGTGG - Intergenic
1022780960 7:33582705-33582727 CAATGTGGCAGATCTGCTCCTGG - Intronic
1022914181 7:34930138-34930160 CAATGAGGTTAATCTGCCTGTGG + Exonic
1032090098 7:128907269-128907291 CAATGGGGCAGGTGTGCTTGGGG + Exonic
1036032380 8:4988806-4988828 CAAAGAGGTTGATCTGCTGGAGG + Intronic
1036676764 8:10840198-10840220 CCGTGAGGCTGAGCTGCTTGAGG - Intergenic
1038132819 8:24752231-24752253 CAAGGAAGCCGATCTGATTGTGG - Intergenic
1038367731 8:26953662-26953684 CAATTAGGGGAATCTGCCTGGGG - Intergenic
1042377785 8:68075535-68075557 CAATGAGGCAGATATACCTGGGG - Intronic
1044297549 8:90546189-90546211 CAATGTGGAGGATCTGTTTAAGG + Intergenic
1053292773 9:36892792-36892814 CAATGAGGTAGATTTGATTGTGG + Intronic
1060080979 9:120645015-120645037 CAGTCAGGAGGATCTGCTTCAGG - Intronic
1060635457 9:125196502-125196524 CAATGAGGTGGGTCTGCAGGAGG - Intergenic
1061508936 9:131048878-131048900 CAGGGACCCGGATCTGCTTGGGG - Intronic
1062534506 9:137015543-137015565 GGATGAGGCTGACCTGCTTGGGG - Exonic
1192392041 X:70739887-70739909 CAATGTGGGAGATTTGCTTGAGG - Intronic
1193904822 X:87229229-87229251 CAATGAGGCTGTACTGCTTGAGG + Intergenic
1194412885 X:93578199-93578221 TCATGAGGCGGCTCTGCATGGGG + Intergenic