ID: 1180569129

View in Genome Browser
Species Human (GRCh38)
Location 22:16699446-16699468
Sequence GCAATAAATCTCATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180569129_1180569132 -4 Left 1180569129 22:16699446-16699468 CCATGATCCATGAGATTTATTGC No data
Right 1180569132 22:16699465-16699487 TTGCTTCAATCCTTGGTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180569129 Original CRISPR GCAATAAATCTCATGGATCA TGG (reversed) Intergenic
No off target data available for this crispr