ID: 1180569495

View in Genome Browser
Species Human (GRCh38)
Location 22:16702059-16702081
Sequence CAAGGTGGTGACCTGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180569495_1180569506 14 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569506 22:16702096-16702118 CACGTGGGCATAGGCAGCAATGG No data
1180569495_1180569507 29 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569507 22:16702111-16702133 AGCAATGGTGTCGCAGAAGCAGG No data
1180569495_1180569502 -2 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569502 22:16702080-16702102 TGCCATGCTGGGCACACACGTGG No data
1180569495_1180569505 5 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data
1180569495_1180569503 -1 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569503 22:16702081-16702103 GCCATGCTGGGCACACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180569495 Original CRISPR CAAGGTGGTGACCTGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr