ID: 1180569500

View in Genome Browser
Species Human (GRCh38)
Location 22:16702074-16702096
Sequence GTGTGCCCAGCATGGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180569500_1180569505 -10 Left 1180569500 22:16702074-16702096 CCACCTTGCCATGCTGGGCACAC No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data
1180569500_1180569506 -1 Left 1180569500 22:16702074-16702096 CCACCTTGCCATGCTGGGCACAC No data
Right 1180569506 22:16702096-16702118 CACGTGGGCATAGGCAGCAATGG No data
1180569500_1180569508 29 Left 1180569500 22:16702074-16702096 CCACCTTGCCATGCTGGGCACAC No data
Right 1180569508 22:16702126-16702148 GAAGCAGGCGCAGTCCCCAATGG No data
1180569500_1180569507 14 Left 1180569500 22:16702074-16702096 CCACCTTGCCATGCTGGGCACAC No data
Right 1180569507 22:16702111-16702133 AGCAATGGTGTCGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180569500 Original CRISPR GTGTGCCCAGCATGGCAAGG TGG (reversed) Intergenic
No off target data available for this crispr