ID: 1180569505

View in Genome Browser
Species Human (GRCh38)
Location 22:16702087-16702109
Sequence CTGGGCACACACGTGGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180569500_1180569505 -10 Left 1180569500 22:16702074-16702096 CCACCTTGCCATGCTGGGCACAC No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data
1180569495_1180569505 5 Left 1180569495 22:16702059-16702081 CCGTCCTCCAGGTCACCACCTTG No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data
1180569497_1180569505 -2 Left 1180569497 22:16702066-16702088 CCAGGTCACCACCTTGCCATGCT No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data
1180569496_1180569505 1 Left 1180569496 22:16702063-16702085 CCTCCAGGTCACCACCTTGCCAT No data
Right 1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180569505 Original CRISPR CTGGGCACACACGTGGGCAT AGG Intergenic
No off target data available for this crispr