ID: 1180570013

View in Genome Browser
Species Human (GRCh38)
Location 22:16705886-16705908
Sequence ACTTTATAAGGGAATATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180570008_1180570013 24 Left 1180570008 22:16705839-16705861 CCTTGATGCTAACACACTGTGCA No data
Right 1180570013 22:16705886-16705908 ACTTTATAAGGGAATATTTAAGG No data
1180570010_1180570013 -9 Left 1180570010 22:16705872-16705894 CCTTTTAAGATATTACTTTATAA No data
Right 1180570013 22:16705886-16705908 ACTTTATAAGGGAATATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180570013 Original CRISPR ACTTTATAAGGGAATATTTA AGG Intergenic