ID: 1180573245

View in Genome Browser
Species Human (GRCh38)
Location 22:16748974-16748996
Sequence CCAGGTGTTTGACATGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180573245_1180573249 1 Left 1180573245 22:16748974-16748996 CCTGGCTCATGTCAAACACCTGG No data
Right 1180573249 22:16748998-16749020 CTCAAACTGTCCTCCTGCGCTGG No data
1180573245_1180573253 26 Left 1180573245 22:16748974-16748996 CCTGGCTCATGTCAAACACCTGG No data
Right 1180573253 22:16749023-16749045 TCCCCAAGTGCTGAGATTACAGG 0: 117
1: 18963
2: 314663
3: 260222
4: 154417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180573245 Original CRISPR CCAGGTGTTTGACATGAGCC AGG (reversed) Intergenic
No off target data available for this crispr