ID: 1180573249

View in Genome Browser
Species Human (GRCh38)
Location 22:16748998-16749020
Sequence CTCAAACTGTCCTCCTGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180573245_1180573249 1 Left 1180573245 22:16748974-16748996 CCTGGCTCATGTCAAACACCTGG No data
Right 1180573249 22:16748998-16749020 CTCAAACTGTCCTCCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180573249 Original CRISPR CTCAAACTGTCCTCCTGCGC TGG Intergenic
No off target data available for this crispr