ID: 1180578340

View in Genome Browser
Species Human (GRCh38)
Location 22:16803157-16803179
Sequence AAGTATATGCAAAAGTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 370}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180578340_1180578342 -6 Left 1180578340 22:16803157-16803179 CCTTTCCACTTTTGCATATACTT 0: 1
1: 0
2: 6
3: 43
4: 370
Right 1180578342 22:16803174-16803196 ATACTTGTTTTGTTGTCTTAAGG 0: 1
1: 0
2: 0
3: 22
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180578340 Original CRISPR AAGTATATGCAAAAGTGGAA AGG (reversed) Intronic
901162404 1:7188816-7188838 GTATATATCCAAAAGTGGAATGG + Intronic
901659876 1:10792354-10792376 AAGTAAATGGAAATGTGGAGGGG + Intronic
903589571 1:24444361-24444383 AAGGGGATGGAAAAGTGGAAAGG + Intronic
903865569 1:26395191-26395213 GAGTCTTTGCAAAAGAGGAAGGG + Intergenic
904172779 1:28603166-28603188 AAGTACAGGGAAAAGGGGAAGGG + Exonic
905543186 1:38776538-38776560 AAGTGTATGCAAAGATAGAATGG + Intergenic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
908725868 1:67176285-67176307 AAGTATAAGAAGAAGAGGAATGG + Intronic
908888898 1:68820260-68820282 TAGTATCTGCAAAAGTATAAAGG + Intergenic
908895847 1:68897468-68897490 AAGAAAAGGCAAAAGTGAAAGGG - Intergenic
909134368 1:71779298-71779320 AAGGAAATGCAAAAGTTTAAAGG + Intronic
909253184 1:73384258-73384280 AAATATATGTAAAAATGGAATGG + Intergenic
909899167 1:81110828-81110850 AAATAAATGCCAAAATGGAATGG + Intergenic
910266214 1:85340580-85340602 AAGTAGCTGTGAAAGTGGAAAGG - Intronic
911601416 1:99852039-99852061 AAGAATATGCAACAGGGGAGGGG - Intronic
911745737 1:101440027-101440049 AAGTATATGCAAATGTGCACTGG - Intergenic
911866203 1:103026027-103026049 AAGGCTAAGCAAAAGTGAAATGG + Intronic
913085492 1:115432802-115432824 ATGTATATGCCAAAGTGTAGAGG - Intergenic
913404486 1:118474434-118474456 GAGTATATGTAAAAATGGGAGGG - Intergenic
915329092 1:155098433-155098455 CAGTATATGCATATGAGGAAAGG - Intergenic
917428495 1:174940599-174940621 ATGTATATGCTAAAGTAGAAGGG - Intronic
917529345 1:175820405-175820427 CAGTATATCCTAAAGTTGAACGG - Intergenic
917605096 1:176619728-176619750 AAGTATATGAAAAAGAAAAATGG - Intronic
917762254 1:178174751-178174773 AAGTAAATGCCAAAGTCAAAGGG - Intronic
917986851 1:180329034-180329056 AATTATATGCAAAAGTTTACAGG - Intronic
918891199 1:190271588-190271610 AAGAATTTGTAAAAGTAGAAAGG - Intronic
919062816 1:192655556-192655578 AAATACATGCAAAAGTGCTATGG - Intronic
919228773 1:194745031-194745053 AGGTACATGCAAAGGAGGAATGG + Intergenic
922943004 1:229484483-229484505 AAGTATATGAATAATTGGTATGG - Intronic
1064591441 10:16896127-16896149 AATGATATGGAAAAGTTGAAAGG - Intronic
1064606673 10:17049083-17049105 AAATATTTCCACAAGTGGAAAGG + Intronic
1064878900 10:20027635-20027657 AAGTATCTTCAAAAGTGCAATGG - Intronic
1065333532 10:24630234-24630256 AACTATATACAAAAGAGGGACGG + Intronic
1065352504 10:24808047-24808069 AATTATATGGAGAAGTAGAATGG + Intergenic
1065978019 10:30860775-30860797 AGGTATAAACAAAAGTGGGAAGG - Intronic
1067350273 10:45469538-45469560 ATGTGTATGCAAAAGTGAACTGG + Intronic
1068554636 10:58445386-58445408 AAGGAAATACAAAAATGGAATGG - Intergenic
1068737859 10:60434969-60434991 AAGTAAATGAAAAAGTGTATTGG + Intronic
1069208274 10:65721190-65721212 ATGTATCTTCAAAAGGGGAAAGG + Intergenic
1069230258 10:66000003-66000025 AAGTATGTATAAAAATGGAATGG - Intronic
1069301975 10:66919294-66919316 AAGCATACGCAAAAGTTGAGAGG - Intronic
1071135008 10:82443688-82443710 AAGTATATGCAAAATGCCAAGGG + Intronic
1071642140 10:87320509-87320531 AAGTATATGTAGGTGTGGAATGG - Intergenic
1072172350 10:92877736-92877758 AAGTATATCCAGAAGTAGTATGG - Intronic
1072176162 10:92923981-92924003 AAATTTGTGCAAAAATGGAAAGG - Intronic
1072536327 10:96366620-96366642 AAGTATATGTAAAAGGTGAAAGG - Exonic
1074727864 10:116332312-116332334 CAGTAAAAGCAAAAGTAGAAAGG - Intronic
1074962418 10:118459262-118459284 CAATATAAGCAAAAGTGGACAGG + Intergenic
1078044409 11:7900128-7900150 AAGTTTATCCAAAAGTGTTATGG - Intergenic
1079913867 11:26343879-26343901 AAGTATCAGAAAAAGTGGGAGGG - Intronic
1079950752 11:26800906-26800928 AAGTCTATGTCAAAGTGGAAAGG + Intergenic
1080172389 11:29320925-29320947 TTGTAAATACAAAAGTGGAAAGG + Intergenic
1080540597 11:33260376-33260398 AAGCATATGGAAAGGAGGAAAGG + Intronic
1080786377 11:35478591-35478613 AAGTAGAGGCAAGAGTGGAGAGG - Intronic
1081216978 11:40412990-40413012 ATGTACATGCAAAAATGGATTGG - Intronic
1082204012 11:49408959-49408981 AAGTATAAGAAAAAGTACAATGG + Intergenic
1083834776 11:65258935-65258957 AAGTATAAGCAAAAGTGGTTGGG + Intergenic
1084139541 11:67216269-67216291 AAGTATAATAAATAGTGGAAGGG + Intronic
1084861070 11:72018582-72018604 AACTATGTGCACAAGGGGAAGGG + Intronic
1085690085 11:78657354-78657376 CAGGATTTGCAAAAGTGGTAGGG + Exonic
1086104784 11:83135530-83135552 AAGTAGATGAAATAGGGGAAAGG - Intergenic
1086116475 11:83256704-83256726 AAGTATATGCAAGGGTCCAAAGG - Intronic
1086931414 11:92697282-92697304 AAGGAAAAGCAAAAGTGGTATGG - Intronic
1087351372 11:97037023-97037045 AAGTATTTGCAAATGTGGTGTGG - Intergenic
1087421640 11:97934266-97934288 AAAGTTATGTAAAAGTGGAATGG + Intergenic
1088069583 11:105765488-105765510 AAGTTGAAGCAAATGTGGAACGG + Intronic
1089176783 11:116554355-116554377 CAGCATATGCAAAAGTGCAGAGG + Intergenic
1089673892 11:120076082-120076104 AAGGATATGCAAACATGGAATGG + Intergenic
1090903151 11:131050152-131050174 AATTATAGGGAAAAGAGGAAAGG - Intergenic
1092518740 12:9243447-9243469 ATATATATACAAAGGTGGAAGGG + Intergenic
1093574659 12:20712787-20712809 AAACATATGGAAATGTGGAAGGG + Intronic
1093725392 12:22502163-22502185 AATTATATTCACATGTGGAAAGG + Intronic
1093815725 12:23544006-23544028 AAATATATGTAAAACTGGTATGG + Intronic
1093962556 12:25291146-25291168 AACTATTTGCAAAGGTGTAATGG + Intergenic
1094202324 12:27806674-27806696 AAGTATTTGTTAAATTGGAAAGG + Intergenic
1094652961 12:32395516-32395538 AAAGATATGGAAAAGTAGAAAGG + Intergenic
1095632978 12:44399662-44399684 AATAATATACAAAAGTAGAAAGG + Intergenic
1096105154 12:48993205-48993227 AGCTGTATGCAACAGTGGAAGGG - Intergenic
1096339725 12:50787414-50787436 AACTATATGAAAAAGTCAAATGG + Intronic
1097674720 12:62587266-62587288 AAGTATATTCAAAATTACAATGG - Intronic
1098738701 12:74142444-74142466 ATCTATATGGAAAAGTAGAAAGG + Intergenic
1098950477 12:76635644-76635666 AAATATATTAAAAAGTTGAAAGG + Intergenic
1099628210 12:85104685-85104707 AAGTATGTTCAACAGGGGAATGG - Intronic
1099966302 12:89449424-89449446 AAGTATATATACATGTGGAATGG - Intronic
1101235169 12:102781294-102781316 AAGAAAATGCAGAAGTGAAAGGG - Intergenic
1101606713 12:106252296-106252318 AAGTCCATGCAGAAGAGGAAGGG + Intronic
1102652745 12:114454296-114454318 AAACATATGCAGAAGTAGAAAGG - Intergenic
1104100191 12:125600353-125600375 AAAGAAATGGAAAAGTGGAATGG - Intronic
1104108622 12:125686288-125686310 AAGTGGATGCAGAAGTGGAGAGG + Intergenic
1106802811 13:33273796-33273818 AAAGATATGTAAAACTGGAAAGG + Intronic
1107187098 13:37536320-37536342 AAGAATATGCAAAAGTATGAAGG + Intergenic
1107612209 13:42126717-42126739 AGGTGTGTGCAAAAGTAGAAAGG - Intronic
1107740926 13:43449808-43449830 AGGTAAATGCAAATGTGGGAAGG + Intronic
1107799477 13:44090863-44090885 AAGTAAATGGAAATGTGGACAGG + Intergenic
1108722090 13:53142535-53142557 CAGTATATGCAAAAGTGCAAAGG - Intergenic
1109439823 13:62354957-62354979 ATATATATCCAGAAGTGGAATGG - Intergenic
1109748535 13:66659017-66659039 AAGTATATGCAAATAAGCAAGGG - Intronic
1110427260 13:75382410-75382432 CAGTATATGCAAAGGTGTCAAGG - Intronic
1110750647 13:79111368-79111390 AAGAATATGTCAAAGTAGAAAGG + Intergenic
1111303399 13:86373883-86373905 GAGGATATGGAAAAGTGGGAAGG - Intergenic
1113127650 13:106997976-106997998 AAGAAAAAGCAAAAGGGGAAGGG + Intergenic
1113313935 13:109158696-109158718 AAGCATATGCAATTGGGGAAAGG + Intronic
1114197315 14:20490221-20490243 AAGTTTACGGAAAAGTAGAAAGG + Intergenic
1114304911 14:21413765-21413787 AAGTAGAAGAAAAAGTGGAATGG - Intronic
1114777557 14:25501809-25501831 AAATATATGCAAAAGTAAAAAGG - Intergenic
1115335706 14:32242691-32242713 AGGTACATGGAAAAATGGAATGG - Intergenic
1115581168 14:34760063-34760085 AAGTATATGCATTGGTAGAAAGG + Intronic
1115602776 14:34971393-34971415 AAGAATAAGTAAAAGTGTAAGGG + Intergenic
1115965740 14:38885413-38885435 AATTATATGAATAAGTGGCAAGG + Intergenic
1116451632 14:45073066-45073088 TAGTTCATGCAAAAGTGGTAAGG - Intronic
1116527206 14:45919451-45919473 AAGAGTATGCAAAAGTGGCATGG - Intergenic
1117580535 14:57146950-57146972 AGATATATGCAAAATTGGCAAGG + Intergenic
1118179677 14:63480016-63480038 AAATATACTCAAAAGTAGAAAGG + Intronic
1119505544 14:75169925-75169947 AAATATAAGAAAAAGTGGAACGG + Intronic
1123510172 15:20990997-20991019 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123567387 15:21564750-21564772 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123603651 15:22002043-22002065 AAGAATATGCAAAAATGGGTTGG - Intergenic
1123915093 15:25016412-25016434 AGGTTGATGCAAGAGTGGAAGGG + Intergenic
1124599610 15:31122358-31122380 AAAGTTATGCAAAATTGGAAAGG + Intronic
1124820923 15:33044863-33044885 AGGTATATGGACAAGTGGAGGGG - Intronic
1125208024 15:37177089-37177111 CAGTATATGGAAAAGTCTAATGG - Intergenic
1126048468 15:44665808-44665830 AAGGATATGAAAATGGGGAAGGG + Exonic
1126104798 15:45140574-45140596 CAGAATGTGCAAAAGTTGAATGG - Intronic
1126666404 15:51079179-51079201 CAGAAAATGCAAAAGTGCAAGGG - Intronic
1127597436 15:60500201-60500223 AAGTATTGGTAAAAATGGAAAGG - Intronic
1129080102 15:73032116-73032138 CAGTAAATGCAACAGGGGAAAGG + Intergenic
1129460022 15:75695923-75695945 AAGTAGAGGGAAAAGTAGAATGG + Intronic
1130682972 15:86012514-86012536 GAGTATGTGCAAAAGCGCAAAGG - Intergenic
1131054346 15:89366858-89366880 AAGTAGCCGCAACAGTGGAAAGG - Intergenic
1131568903 15:93512483-93512505 ATGTATATGCATTTGTGGAAAGG + Intergenic
1131939984 15:97551511-97551533 AAGTATAGGCAAGAGAGAAAAGG - Intergenic
1131950168 15:97673277-97673299 AAGCATATGGAAAAGTAAAAGGG - Intergenic
1202975751 15_KI270727v1_random:291844-291866 AAGAATATGCAAAAATGGGTTGG - Intergenic
1133515390 16:6503808-6503830 AGGTATATGCAAATGGGGATGGG + Intronic
1135658779 16:24276394-24276416 AATAATTTGCAAAAGTGTAAAGG + Intronic
1135949267 16:26898070-26898092 AAGTATGTGAAGTAGTGGAATGG + Intergenic
1138150882 16:54655650-54655672 AAGAAAAAGCAGAAGTGGAAAGG + Intergenic
1138176703 16:54906412-54906434 AAGTATACGCAATAGGGAAAAGG + Intergenic
1139058220 16:63214157-63214179 AATAAAATGTAAAAGTGGAAAGG + Intergenic
1142294997 16:89215516-89215538 ATATATATGCAAAAGTGGAATGG - Intergenic
1142878707 17:2868098-2868120 AAGCATAAGCAAAACAGGAAGGG - Intronic
1143930931 17:10423318-10423340 AAACATATGCAAAAGTAGAGGGG + Intergenic
1146910851 17:36647500-36647522 AAGTATATGGAAAGGGGGAAGGG - Intergenic
1147340319 17:39749982-39750004 AAGCATATACAAAGGTGGAGAGG - Intergenic
1147788111 17:42994857-42994879 AAGGATATGCAAGAATGGAAGGG + Intergenic
1148046367 17:44747434-44747456 ATCTATATGCAGAAGTGGACAGG + Exonic
1148404843 17:47402153-47402175 AAGAATTTGCAAAAGTAGTAAGG + Exonic
1149957686 17:61071014-61071036 CAGTATATGCATAAGTTAAAGGG - Intronic
1150548693 17:66189517-66189539 AAGTATTTTGAAAAGTAGAAAGG + Intronic
1152853727 17:82651842-82651864 AAGAATCTGCAACAGGGGAAGGG + Intergenic
1153537858 18:6121951-6121973 ATGTATATGCAGAACTGGAGTGG - Intronic
1153902084 18:9626260-9626282 AGGTATATGCAGAAATGCAAAGG + Intergenic
1154512043 18:15116181-15116203 AAGAATATTCCAAATTGGAAAGG - Intergenic
1155902700 18:31410988-31411010 AAGTCTGTGCAAATGTGGGAAGG + Intronic
1156224175 18:35086623-35086645 AATTATATGTAAAAATTGAAAGG - Intronic
1156545242 18:37957495-37957517 AATTATAGGAAAAAGTGGAGGGG + Intergenic
1157637910 18:49179920-49179942 AAGTTTATACTAAAGTGGAGAGG + Intronic
1157858997 18:51124385-51124407 AATGATATGGAAAAGGGGAAAGG - Intergenic
1158015479 18:52777877-52777899 AGGTAGATGGAAAAATGGAAAGG + Intronic
1158779722 18:60632798-60632820 AAGAAAGTGAAAAAGTGGAATGG + Intergenic
1159041768 18:63330840-63330862 CAGTATAAGCAAAATTGGAAAGG + Exonic
1159049902 18:63410741-63410763 AACTATCTGCAAAAATGTAAGGG - Intronic
1159742581 18:72191006-72191028 AAGTTTAAGCAAACTTGGAATGG - Intergenic
1160022910 18:75194324-75194346 AAGTATATGTACAAGTTGAAAGG + Intergenic
1161926089 19:7301047-7301069 AAGTATATGCAACAGATAAAAGG + Intergenic
1165587992 19:36937960-36937982 AAGTGTATGCAACTGTGGAAAGG - Intronic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
1168428699 19:56259675-56259697 AAGTAAATGAAAAAGTTGACCGG + Intronic
1168586242 19:57595242-57595264 AAGTATATACACAAATGGAAAGG + Intergenic
1168680496 19:58312064-58312086 AAGTTTATCCAAAAGTGTTATGG + Intronic
925623749 2:5821112-5821134 CAGCATATTCAATAGTGGAAAGG + Intergenic
926038105 2:9650776-9650798 AAATATATGCAGCGGTGGAATGG - Intergenic
926627959 2:15109444-15109466 AATTATATCCAAAAGTGCTATGG + Intergenic
927412286 2:22840634-22840656 AAGTAAATAAAAAAGTGAAAAGG + Intergenic
928331837 2:30363739-30363761 AAGTAAATGAACAAGTGCAATGG + Intergenic
928345106 2:30485944-30485966 AAATATATGCTGAAGTAGAAAGG - Intronic
928717892 2:34083925-34083947 AAGTATATATACATGTGGAATGG + Intergenic
929014088 2:37476640-37476662 AAAAACATGCAAAAGTGAAAAGG - Intergenic
929427557 2:41858874-41858896 AATTGTATGGAATAGTGGAAGGG + Intergenic
930269108 2:49235090-49235112 AAGCATATGCAACATTGGTAAGG + Intergenic
930972363 2:57411162-57411184 AAGGATATGCAAAAAAGAAATGG + Intergenic
931002525 2:57803334-57803356 AAATTTATGTAAAAGTGAAATGG + Intergenic
933374157 2:81457966-81457988 AAGGATATTCAAAAGTGAGAGGG + Intergenic
933476131 2:82792937-82792959 AGGTATATGTCAAAGAGGAAGGG - Intergenic
933932211 2:87164438-87164460 AAGTATATGCAAATGCAGTAAGG - Intergenic
935039327 2:99410896-99410918 AGGTATATAGGAAAGTGGAATGG - Intronic
935429746 2:102962734-102962756 AAGTAGATACCAAAGTGGCAGGG - Intergenic
935643823 2:105316175-105316197 AACTAGATGCGTAAGTGGAAAGG + Intronic
936360903 2:111800995-111801017 AAGTATATGCAAATGCAGGAAGG + Intronic
936700892 2:115009969-115009991 AAGTAGATGCCAAACTGAAAAGG - Intronic
938076572 2:128341449-128341471 ATGTAACTGCAAAAGTGGGAAGG - Intergenic
938319333 2:130352587-130352609 AAGTTAAAACAAAAGTGGAAGGG - Intergenic
938511614 2:131952952-131952974 AAGAATATTCCAAATTGGAAAGG - Intergenic
938784723 2:134616105-134616127 AAGTCAAAGCAAAAGTGGACTGG + Intronic
939054090 2:137341724-137341746 AAGAATATGCAATAGTAAAAAGG - Intronic
940599112 2:155835136-155835158 AAATACCTGCAAAAGAGGAAGGG + Intergenic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941241833 2:163048285-163048307 ATATCTCTGCAAAAGTGGAATGG - Intergenic
941619978 2:167766390-167766412 AAGTTCATGGAAAAATGGAATGG + Intergenic
942699474 2:178688205-178688227 AAGTATCTGCAGAGGAGGAATGG - Exonic
943199925 2:184809285-184809307 AAGTATACACATAAGTGGAAGGG + Intronic
943238895 2:185359804-185359826 AAGTATATGCTGAAGAGGCAGGG - Intergenic
943290235 2:186061735-186061757 AAGTATATGAAAAAGTACAATGG + Intergenic
943428925 2:187773375-187773397 AAGTACATTGAAATGTGGAAGGG + Intergenic
943748084 2:191483182-191483204 AAGTATATCCAAAAAAGGAAAGG - Intergenic
943785289 2:191871026-191871048 ATTTATAAGGAAAAGTGGAAGGG - Intergenic
944287883 2:197972880-197972902 AAGTGTATGGAGAACTGGAAGGG - Intronic
945718812 2:213392113-213392135 AACCATATGCAAATGTGAAAAGG + Intronic
946464509 2:219899658-219899680 AAGTAAATTGAAAACTGGAAAGG - Intergenic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
947258918 2:228198755-228198777 AAGCAAATGCGAAGGTGGAAAGG - Intergenic
947323718 2:228951636-228951658 AGGTATATGCCAAAGAGGAATGG + Intronic
947677756 2:231999515-231999537 ACAAATATGGAAAAGTGGAAAGG - Intronic
948445150 2:238026774-238026796 CAGTATATACAAAAATGAAATGG - Intronic
1168905537 20:1400679-1400701 AAGTGTATCCAAAAGTGTTATGG + Intergenic
1169789378 20:9393245-9393267 AAGTATCTGGTAAAGTGCAAGGG - Intronic
1170263924 20:14443607-14443629 TATTATATGCCAAAATGGAAAGG + Intronic
1170450450 20:16478066-16478088 AAGTTTATGCAAAACTGAAGTGG + Intronic
1173048823 20:39539341-39539363 AAATATTTTCAAAAGTGAAATGG - Intergenic
1173886561 20:46464369-46464391 AAGTATATTCACAAGTGGAAGGG - Intergenic
1175042616 20:56069538-56069560 AAGTATATGGAAAATTGCATAGG - Intergenic
1176695655 21:9974032-9974054 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
1177677634 21:24322467-24322489 AAGTAAATGGAAATGTGGGAGGG - Intergenic
1178164646 21:29959761-29959783 AAATTTATTAAAAAGTGGAAAGG - Intergenic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1181173717 22:21024260-21024282 AAGTTTAGGTAAAAGCGGAAGGG - Intronic
1183388041 22:37526308-37526330 AAGAAGAGGCAAAAGAGGAAAGG + Intergenic
1184253500 22:43274304-43274326 AAGTATGTTCAAAAGTTGCATGG + Intronic
1184420180 22:44376407-44376429 CAGTAAATGCAAAAATGCAAGGG - Intergenic
949862835 3:8522151-8522173 AAGTAAATCCATATGTGGAAAGG - Intronic
949967459 3:9370096-9370118 AAGTATATTTAAAAGTTTAAGGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950623697 3:14228556-14228578 AAGTTTATCCAAAAGTGTTATGG + Intergenic
951158436 3:19384395-19384417 AAGTATATTGAAAAGCTGAAAGG + Intronic
951918717 3:27829535-27829557 AAGTAAATCAGAAAGTGGAATGG - Intergenic
952307224 3:32157025-32157047 AAGGAGCTGGAAAAGTGGAAGGG + Intronic
953151200 3:40326681-40326703 AAGGATATGAAAATGTGAAAGGG + Intergenic
954176048 3:48846890-48846912 AAGCATAGACAAAAGAGGAAAGG - Intronic
954470237 3:50687758-50687780 CAGTATATGCATAGATGGAATGG - Intronic
954477258 3:50759108-50759130 ATATATACGCAGAAGTGGAATGG + Intronic
954501957 3:51025785-51025807 AAGTAGAAGCAACAGTGGGAAGG - Intronic
954986403 3:54797586-54797608 AAGAACTTGCAAAAGTGAAATGG - Intronic
955039946 3:55306514-55306536 AAATATATGCAACAGGGGATTGG + Intergenic
957121389 3:76098845-76098867 AGGTATATGCAATAGCTGAAAGG - Intronic
957408157 3:79798984-79799006 AATTAAATGGAAAAGTGAAAAGG - Intergenic
957638699 3:82820507-82820529 AAATATTTATAAAAGTGGAAAGG - Intergenic
958029870 3:88095847-88095869 GAGTATCTGCTGAAGTGGAAAGG - Intronic
958437389 3:94113505-94113527 AGGGATATGAAAAAGAGGAAAGG + Intronic
958535153 3:95392128-95392150 AAGTGTTTGAAAAACTGGAAAGG + Intergenic
959244150 3:103841976-103841998 AAGATTATGAAAAAGTGGTATGG - Intergenic
959318500 3:104840678-104840700 AAGAAAATGCAAATGTGGTAAGG + Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
959726777 3:109552247-109552269 AAATATCTGCCAAAGTGCAATGG + Intergenic
960663577 3:120087830-120087852 AAATATAAGCAAAAATGGTAAGG + Intronic
961993931 3:131220963-131220985 AAGTATGTGAAAAAGAGGAAAGG + Intronic
962412265 3:135151494-135151516 AAGTACATGAAAAAATGGAAAGG - Intronic
963558942 3:146835567-146835589 AAGCAAAAGCAAAAGAGGAAGGG + Intergenic
963609810 3:147452949-147452971 ATATATATCAAAAAGTGGAAAGG - Intronic
963853314 3:150228488-150228510 AAGGAAAAGCAAAACTGGAAGGG - Intergenic
965281005 3:166752656-166752678 AAGTAAGTGCAAAGGTGGCAGGG - Intergenic
965750959 3:171974716-171974738 AAGCATGTGCAAAAGTGCAGAGG + Intergenic
966024971 3:175267740-175267762 AAGTATAAACAAATGTGGACAGG - Intronic
966635154 3:182124591-182124613 AAGTATGTGCAAAAGTCCAGAGG - Intergenic
969054680 4:4394223-4394245 AAGGATTTGAAGAAGTGGAATGG - Intronic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
970132767 4:12889422-12889444 AAGTATATTAAACAGAGGAATGG + Intergenic
971286232 4:25292628-25292650 AAGTATATGAATATGTGGACAGG + Intergenic
971473560 4:27051683-27051705 CAGAATTTGCAAAAGTTGAATGG + Intergenic
972001077 4:34034181-34034203 AAGAATAACCAGAAGTGGAAGGG + Intergenic
972614833 4:40687889-40687911 AAGCACATGCAATAGTAGAATGG + Intergenic
973284998 4:48404951-48404973 AAGTTTATGTATAAGTGGAGGGG - Intronic
973971211 4:56215468-56215490 AATCATATGCACAAGTGCAATGG - Intronic
975053730 4:69900347-69900369 AATTATGTGAGAAAGTGGAAAGG + Intergenic
975416097 4:74106290-74106312 AAGTAGCTGAAAAGGTGGAATGG + Intergenic
975737438 4:77394817-77394839 AAGTTTATCCAAAAGTGTTATGG - Intronic
976242678 4:82974879-82974901 ACGTAGATACAAAAGTGGGATGG + Intronic
977145658 4:93436712-93436734 AAATATTTGTAAAAGTGTAATGG + Intronic
977203000 4:94139038-94139060 AAATGTATGCAAAAATGCAAAGG + Intergenic
978343714 4:107743474-107743496 AACTAGATGGAAAAGTTGAAGGG + Intergenic
978959462 4:114658601-114658623 AAGTATAATTAAAAGTTGAACGG - Intronic
979105763 4:116684823-116684845 AAATATATTCAACAGAGGAAAGG - Intergenic
979482270 4:121233740-121233762 AAGTGAATGCAGAAGTTGAATGG - Intergenic
979587174 4:122434046-122434068 TGGTATATGCAGAAGTGGGAGGG - Intergenic
980143609 4:128952433-128952455 AAGTATATATAACAGTGGGAAGG - Intronic
980368278 4:131834265-131834287 ATATATTTCCAAAAGTGGAAAGG - Intergenic
980818823 4:137985803-137985825 AAGTATATGATAAATTGTAATGG - Intergenic
982377525 4:154709584-154709606 AAGTAGATCCAAATGTGGAAAGG - Intronic
984011298 4:174374986-174375008 AAATATATGGAAAGGTGCAAGGG + Intergenic
984782178 4:183535931-183535953 AAGTATAAGCAATAGTGCATGGG - Intergenic
985299050 4:188468281-188468303 AAATATGTACAAAAGTGAAAGGG - Intergenic
986433640 5:7706207-7706229 AAGAATGTGCACAACTGGAAAGG + Intronic
987567309 5:19608108-19608130 AAGGATATAGAAAATTGGAATGG + Intronic
987920041 5:24267985-24268007 AAGTAAATTGAAAACTGGAAAGG + Intergenic
987953300 5:24704214-24704236 AATTATATTCAAAAGTGGAATGG - Intergenic
987968758 5:24913615-24913637 AAATATATGCAATAGGTGAAAGG + Intergenic
989388122 5:40873227-40873249 AAGAATAAGCAAAAGTGGCCAGG + Intergenic
989652801 5:43712251-43712273 ATGTATAGCCAAAAGTTGAAAGG + Intergenic
991084821 5:62639185-62639207 AAGTAAGTGTAAAAGTGGAATGG + Intergenic
991971779 5:72148424-72148446 AAGGATATTCAAAACTGGCAGGG - Intronic
991985864 5:72286296-72286318 AAGAACATGCAAAAGTTGAAGGG + Intronic
992957257 5:81922602-81922624 GTGTGTAAGCAAAAGTGGAAGGG + Intergenic
994384811 5:99118702-99118724 CAGTCAATGCAAAAGTGGACTGG + Intergenic
994439265 5:99781536-99781558 AACTATATGACAAATTGGAATGG - Intergenic
994687003 5:102968246-102968268 ATGTATAGGAAAAAGTGTAATGG + Intronic
997308424 5:132858019-132858041 AAATATATTTAAAAGTGGACAGG + Intergenic
997380796 5:133436156-133436178 AAGTATATGTAAAATTACAATGG + Intronic
997917107 5:137938174-137938196 TAGAATATGTAAAAGTGGCATGG - Exonic
998024041 5:138798166-138798188 AAGTAGATGGAAAAATAGAAGGG + Intronic
998347816 5:141479729-141479751 AAGTATATGCACAATGTGAAAGG + Intronic
998440391 5:142155992-142156014 AGGTATACGCAAAAGGGAAAAGG - Intergenic
998859340 5:146427406-146427428 AAGTAAATGAAAAAATGGAATGG - Intergenic
999211029 5:149888692-149888714 AAGTATAGGAAAAAGTTGAATGG + Intronic
1000890495 5:166795988-166796010 AGTTATATGGAAAAGTCGAAGGG + Intergenic
1005167962 6:22947523-22947545 ACTTATGTGCAAGAGTGGAAGGG - Intergenic
1007805461 6:44441466-44441488 ATGTATAGCCAGAAGTGGAATGG + Intronic
1008312682 6:49996078-49996100 AAGTCAATGCAAAAGTGAACTGG - Intergenic
1008692306 6:53993145-53993167 AGGTACATGCAAATATGGAATGG - Intronic
1010116559 6:72318484-72318506 AAGAATATGCAAATGGGGGAGGG - Intronic
1010930198 6:81792168-81792190 AGGTAGATCCACAAGTGGAAAGG - Intergenic
1011736312 6:90313896-90313918 AAGAATATGCAGAAGGGGATGGG - Intergenic
1011890928 6:92159038-92159060 AAGTATATGCATATGTGGTACGG + Intergenic
1012290717 6:97452374-97452396 AAGTCTATGCTAAATTGAAATGG - Intergenic
1012377418 6:98579224-98579246 AAGTATATGCAAAAGTGAAGAGG - Intergenic
1013765864 6:113573506-113573528 AAGTATATACATAGATGGAAGGG - Intergenic
1013865978 6:114696713-114696735 GAGTATTTGACAAAGTGGAAAGG + Intergenic
1014280581 6:119438705-119438727 AAGGATATACAAATGTGAAAGGG - Intergenic
1014334514 6:120116165-120116187 AAGTATATAAAAAAGTCAAATGG - Intergenic
1014339359 6:120183929-120183951 AAAGATATCCAAAATTGGAAAGG - Intergenic
1014892224 6:126856556-126856578 AAATATGTGCAAAAATGGACTGG - Intergenic
1015459209 6:133469640-133469662 ATCTATATGCAAAAGAGGAAAGG + Intronic
1016146240 6:140677816-140677838 AAGGGTATGCAAAAGTCAAATGG - Intergenic
1016535094 6:145101128-145101150 AAATATTTGAAAAAGTGGCAGGG + Intergenic
1016812704 6:148276574-148276596 AAGTATATGCAAAGGGAAAAGGG + Intronic
1018595951 6:165480597-165480619 AAGTATATGAGAAAGAGAAAGGG + Intronic
1020719702 7:11726570-11726592 AAGTTAATGCAAAAGGGGAAAGG - Intronic
1020845377 7:13274870-13274892 AATACTATGCAAAAGGGGAAAGG - Intergenic
1020892968 7:13902629-13902651 AACTATATGCAAACCTGGAGGGG + Intronic
1021712651 7:23431440-23431462 AAGTATCTGTAAAAGTGGAAAGG + Intronic
1023309630 7:38871065-38871087 AAGGATAAGGAAAAATGGAAAGG + Intronic
1023595494 7:41825426-41825448 AAGTATATGCATCAGGGCAAAGG + Intergenic
1023640795 7:42254997-42255019 GAGCAGATGGAAAAGTGGAAGGG - Intergenic
1024521905 7:50312703-50312725 ACTGATATGCAAAAGAGGAAGGG - Intronic
1024920751 7:54551617-54551639 AGGTATATGCTAAATTGTAATGG + Intronic
1025060285 7:55799569-55799591 AATTATAGGCAAAAGAGGACAGG + Intronic
1026188427 7:68102512-68102534 AAGTGGATGCAAAAGAGGGATGG + Intergenic
1026439372 7:70430652-70430674 AAGAATATGCAGAAAAGGAAGGG + Intronic
1027714504 7:81653146-81653168 ATGTTTATGCAAAAGAGGACAGG - Intergenic
1028521598 7:91737602-91737624 AAGGACATCCAAAATTGGAATGG - Intronic
1030437179 7:109537434-109537456 AAGTATTTGCATGAGTGAAAAGG + Intergenic
1030528289 7:110679738-110679760 AAGTAGAGACAAAAGAGGAAAGG - Intronic
1031203338 7:118720437-118720459 AAGTATTTTCAACAGGGGAATGG - Intergenic
1031746931 7:125510828-125510850 AGGGATTTCCAAAAGTGGAATGG - Intergenic
1031797004 7:126187180-126187202 AAATACATGTGAAAGTGGAAGGG + Intergenic
1031843178 7:126772028-126772050 AATTTTAGGCAGAAGTGGAAAGG - Intronic
1031950282 7:127884855-127884877 AGGTATATACAAATATGGAAAGG - Intronic
1032142206 7:129342131-129342153 AATTATATGCAAAAGTACAGGGG + Intronic
1033094514 7:138418889-138418911 AATTTTATGCAAAATTAGAAAGG - Intergenic
1035878348 8:3216734-3216756 AAAGGTATGCATAAGTGGAACGG - Intronic
1036057865 8:5279891-5279913 AAGTGTATGCACAAGTCAAATGG - Intergenic
1036534570 8:9634597-9634619 AAGAAGATACAAATGTGGAAGGG + Intronic
1037021132 8:13972209-13972231 ATGCATATGCAAAAGTGCATTGG - Intergenic
1037045154 8:14290824-14290846 AAATATATGCAGTAGTGGTATGG - Intronic
1037715859 8:21399571-21399593 TAGTATAAGAAAAACTGGAATGG - Intergenic
1038380375 8:27087231-27087253 AAGTATTTGCAAAACTGTAAAGG + Exonic
1038644701 8:29351882-29351904 AATTAAATGCAAAAGAGAAATGG - Intergenic
1039771506 8:40692684-40692706 AAGATTATGCATAATTGGAATGG - Intronic
1040662312 8:49588271-49588293 AAATATAATCAAAATTGGAAAGG + Intergenic
1040812423 8:51470472-51470494 AAGTCTGTGCAAGAATGGAAGGG + Intronic
1041073493 8:54148041-54148063 AATGAAATGCACAAGTGGAATGG + Intergenic
1042684738 8:71425620-71425642 AAGAATATCCAAATCTGGAAAGG - Intronic
1042829112 8:73007762-73007784 AAGTGTGTGAAAATGTGGAAAGG + Intergenic
1043239553 8:77915893-77915915 AAGTATAGACTAAAATGGAAAGG - Intergenic
1043562515 8:81510817-81510839 GAGTATCTGCAGCAGTGGAATGG + Intergenic
1045451750 8:102333849-102333871 AAGCATATGGAAAAGCGGATAGG - Intronic
1045694670 8:104795034-104795056 CAGTACATGAAAAAGTGGGAGGG - Intronic
1045842668 8:106597923-106597945 TAGTATGTGCAAAAGTCCAAAGG - Intronic
1045979210 8:108164701-108164723 TAGTAAATGCTAAAATGGAAGGG + Intergenic
1046193583 8:110831498-110831520 AAGTATCTGGTAAGGTGGAACGG + Intergenic
1046680022 8:117158377-117158399 AAGAAAATGCAAAAGTAAAATGG - Intronic
1047135917 8:122078482-122078504 AATTATAAGCAAAATTTGAAAGG + Intergenic
1047870242 8:129074478-129074500 AAGAATCTGCCAAAGTGGAATGG - Intergenic
1048298669 8:133235378-133235400 ATGAATATGGAAAAGTGGAAAGG + Intergenic
1050634886 9:7601892-7601914 TAGTATTTGCAGGAGTGGAAAGG + Intergenic
1050837771 9:10105484-10105506 AAGTAGAGGTAAAAGTGGAGGGG - Intronic
1052185016 9:25582864-25582886 GAGTATATAAAACAGTGGAAAGG + Intergenic
1053632639 9:39959989-39960011 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
1053773121 9:41503544-41503566 ATGTATTTCCAAAAGTGGAAAGG + Intergenic
1054211249 9:62290708-62290730 ATGTATTTCCAAAAGTGGAAAGG + Intergenic
1054313731 9:63558138-63558160 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
1055392938 9:75843033-75843055 AAGTGTAAGCACAAGTGAAATGG + Intergenic
1055663882 9:78534084-78534106 AATTAAATGCAAACTTGGAATGG - Intergenic
1056464873 9:86843732-86843754 AAGTACATGCAAAACTATAAAGG - Intergenic
1056575725 9:87855095-87855117 AAGTAAATGGACAAGGGGAAGGG + Intergenic
1057122777 9:92591783-92591805 AAGCATTTTCCAAAGTGGAAGGG + Intronic
1058720938 9:107763004-107763026 AAATATAGGCAAAAGTTGCATGG - Intergenic
1058822265 9:108743700-108743722 AAGAATACACAAAAGAGGAAAGG + Intergenic
1058931667 9:109726176-109726198 ATGTCTATGCTCAAGTGGAAAGG - Intronic
1059621136 9:116006851-116006873 TAGTATATGCAAAAGCATAAAGG + Intergenic
1060131646 9:121106033-121106055 CAGAATATTCAAAAGTGGAGTGG + Intronic
1061017029 9:127987243-127987265 AATTATTTGCACAACTGGAATGG + Intergenic
1186361170 X:8843633-8843655 AAGAATCTGCAAAAGTTGCATGG + Intergenic
1187028018 X:15456219-15456241 AAGCATTTGCAAAACTGGAAAGG - Intronic
1188650326 X:32624212-32624234 AAGTAAAAGCAAAAGGTGAATGG + Intronic
1188881053 X:35492393-35492415 AAATAAGTGCAAAAATGGAAGGG - Intergenic
1188986058 X:36769314-36769336 AAGTATGTGCTGAAGTAGAAGGG - Intergenic
1190278309 X:48913344-48913366 AAGAATCTGCAAAAGTTGGAGGG + Exonic
1190818313 X:53948709-53948731 AAACATATGTAAAAGTAGAAGGG - Intronic
1192804040 X:74494291-74494313 AAGCCTATACACAAGTGGAAGGG + Intronic
1192961472 X:76135824-76135846 AATTATATGAAAAAGTGGGTGGG - Intergenic
1194238511 X:91414492-91414514 AAGTATTGGCAATAATGGAATGG - Intergenic
1194318131 X:92407829-92407851 CAGTATCTGCAAAAGTGTAGGGG - Intronic
1194493145 X:94576532-94576554 TAGTATATGCAAAAGTACAGAGG - Intergenic
1196207145 X:112953568-112953590 CATCATATGCAAAGGTGGAAAGG - Intergenic
1196663825 X:118295587-118295609 AAGGACAAGCAATAGTGGAAAGG - Intergenic
1196988923 X:121306182-121306204 AAGGATATGAAAGAGTGGGAAGG + Intergenic
1198308179 X:135403075-135403097 CAGTATTTGCAAAAGGGGAGGGG - Intergenic
1199432280 X:147774916-147774938 AAGTAGAAACAAGAGTGGAAAGG + Intergenic
1200626301 Y:5521118-5521140 CAGTATCTGCAAAAGTGTAGGGG - Intronic
1201937559 Y:19424453-19424475 AAGTTTCAGCAAAAGTAGAATGG + Intergenic