ID: 1180581565

View in Genome Browser
Species Human (GRCh38)
Location 22:16844179-16844201
Sequence CTCTGTAGGCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180581557_1180581565 20 Left 1180581557 22:16844136-16844158 CCTGGTGGCTCTGCTGAGAGCAT No data
Right 1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180581565 Original CRISPR CTCTGTAGGCAGAGGGAGGA GGG Intergenic
No off target data available for this crispr