ID: 1180587000

View in Genome Browser
Species Human (GRCh38)
Location 22:16901613-16901635
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180586997_1180587000 3 Left 1180586997 22:16901587-16901609 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586993_1180587000 11 Left 1180586993 22:16901579-16901601 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586991_1180587000 18 Left 1180586991 22:16901572-16901594 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586995_1180587000 7 Left 1180586995 22:16901583-16901605 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586992_1180587000 17 Left 1180586992 22:16901573-16901595 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586990_1180587000 23 Left 1180586990 22:16901567-16901589 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data
1180586994_1180587000 8 Left 1180586994 22:16901582-16901604 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1180587000 22:16901613-16901635 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180587000 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr