ID: 1180587041

View in Genome Browser
Species Human (GRCh38)
Location 22:16901929-16901951
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180587037_1180587041 15 Left 1180587037 22:16901891-16901913 CCCAGTATAGGACAAGAGCTGTC No data
Right 1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG No data
1180587036_1180587041 24 Left 1180587036 22:16901882-16901904 CCACAAAAGCCCAGTATAGGACA No data
Right 1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG No data
1180587038_1180587041 14 Left 1180587038 22:16901892-16901914 CCAGTATAGGACAAGAGCTGTCT No data
Right 1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180587041 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr