ID: 1180592436

View in Genome Browser
Species Human (GRCh38)
Location 22:16952649-16952671
Sequence ACATACACACACATAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3332
Summary {0: 2, 1: 5, 2: 64, 3: 439, 4: 2822}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180592436_1180592438 -7 Left 1180592436 22:16952649-16952671 CCTCTCTCTATGTGTGTGTATGT 0: 2
1: 5
2: 64
3: 439
4: 2822
Right 1180592438 22:16952665-16952687 TGTATGTGTGTGTGCATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180592436 Original CRISPR ACATACACACACATAGAGAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr