ID: 1180592436 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:16952649-16952671 |
| Sequence | ACATACACACACATAGAGAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3332 | |||
| Summary | {0: 2, 1: 5, 2: 64, 3: 439, 4: 2822} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180592436_1180592438 | -7 | Left | 1180592436 | 22:16952649-16952671 | CCTCTCTCTATGTGTGTGTATGT | 0: 2 1: 5 2: 64 3: 439 4: 2822 |
||
| Right | 1180592438 | 22:16952665-16952687 | TGTATGTGTGTGTGCATGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180592436 | Original CRISPR | ACATACACACACATAGAGAG AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||