ID: 1180594945

View in Genome Browser
Species Human (GRCh38)
Location 22:16966999-16967021
Sequence TGAAGCTATCAGAGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180594939_1180594945 28 Left 1180594939 22:16966948-16966970 CCAAGGCAGCATACAATTATAAG 0: 1
1: 0
2: 24
3: 34
4: 153
Right 1180594945 22:16966999-16967021 TGAAGCTATCAGAGTGACCTTGG 0: 1
1: 1
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180594945 Original CRISPR TGAAGCTATCAGAGTGACCT TGG Intronic
901218295 1:7567062-7567084 TGAGGCCAGCTGAGTGACCTTGG + Intronic
907084356 1:51656118-51656140 AGAAACAATCAGAGAGACCTGGG + Intronic
907460461 1:54602465-54602487 TCAAACTCTCTGAGTGACCTGGG - Intronic
908337933 1:63146493-63146515 TGAAGCTACAACAGTCACCTTGG - Intergenic
908776264 1:67643380-67643402 TGAATCTTTCTGAGTGACCTTGG + Intergenic
911068155 1:93810512-93810534 TGAAGCCATGAAAGTGTCCTAGG - Intronic
912875890 1:113359132-113359154 TGAAACTACTAGAGTCACCTGGG + Intergenic
917483476 1:175433363-175433385 TGATGCTTTGAGGGTGACCTGGG + Intronic
920335581 1:205243026-205243048 TGAAGCTATCAAAGGGTGCTAGG + Intronic
921485783 1:215713922-215713944 TGCAGCTAGCTGTGTGACCTTGG + Intronic
922205379 1:223441811-223441833 TGAAGGTCACAGGGTGACCTGGG + Intergenic
1063114672 10:3065826-3065848 TGCACTTATCAGAGTAACCTAGG + Intergenic
1063723031 10:8603833-8603855 TATAGCTATGAGAGTGACATGGG + Intergenic
1064808706 10:19167761-19167783 TGAAGTTAGAAGAGTAACCTGGG - Intronic
1066239344 10:33518177-33518199 TGATGTTAACAGAGTGACTTTGG - Intergenic
1068514325 10:58007178-58007200 GGAAACTACCAGTGTGACCTTGG - Intergenic
1070986675 10:80695560-80695582 TTCAGCTCTCAGAGTGATCTTGG - Intergenic
1071065107 10:81622796-81622818 ACAAGCTATCAGAGTGAACCAGG - Intergenic
1071169654 10:82849260-82849282 AGAAGCTAGGAGAGTGACATAGG + Intronic
1075420093 10:122294261-122294283 TGATGCTATCAGAGTGACCTGGG - Intronic
1078182234 11:9021735-9021757 TGAAGGTATAAAACTGACCTTGG + Intronic
1078345681 11:10545453-10545475 AGAAGATATCTTAGTGACCTTGG + Intergenic
1080789097 11:35504491-35504513 TGAAGCCATCAGATGGTCCTGGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085646075 11:78223789-78223811 TGAAGCTGTAAGGGAGACCTTGG + Intronic
1088535053 11:110851520-110851542 TGATGCTAATATAGTGACCTAGG + Intergenic
1089999846 11:122947173-122947195 TTAAGATATGAGAATGACCTGGG - Intronic
1092978070 12:13765033-13765055 TGAAGCTATCAGGCTCACATCGG + Intronic
1098861495 12:75715944-75715966 TTAAACTATCTGTGTGACCTTGG - Intergenic
1099286633 12:80720724-80720746 TGATGCTAACAGAGTGACAGTGG - Intergenic
1099321255 12:81152590-81152612 TGAATATATCAGTGTCACCTAGG + Intronic
1099977190 12:89558227-89558249 AGAAAATATCAGAGTGACCTGGG + Intergenic
1103137393 12:118519368-118519390 TGTAGCTATCACAGGGGCCTTGG - Intergenic
1103799962 12:123531897-123531919 TCAGGCTCCCAGAGTGACCTCGG + Intronic
1107578249 13:41750955-41750977 TGAAGCTAGCTGTGTGACCTTGG + Intronic
1107845009 13:44503274-44503296 AGAAACTATCAGAGGGAACTAGG - Intronic
1109766013 13:66898869-66898891 TCTAGCTATCAGTGTGTCCTTGG + Intronic
1110022526 13:70492833-70492855 TGAAGCCTACAGAGTGAGCTGGG + Intergenic
1114317632 14:21523057-21523079 GGAAGCCACCAGCGTGACCTTGG - Exonic
1116207114 14:41882629-41882651 TGAAGGTATGAGAATGACATAGG + Intronic
1116210092 14:41927599-41927621 TAATGCTCACAGAGTGACCTGGG - Intergenic
1118259858 14:64236534-64236556 TGCAGCTATCAGAGGTACCAGGG + Intronic
1120858478 14:89233754-89233776 TGCTACTAGCAGAGTGACCTCGG + Intronic
1121554430 14:94825535-94825557 TGAAGCTTGCAGAGAGGCCTGGG + Intergenic
1121631076 14:95422407-95422429 TGAGCCTATCTGTGTGACCTTGG - Intronic
1123723587 15:23081239-23081261 GTAAGCTATCAGAGTTGCCTAGG + Intergenic
1123973296 15:25528652-25528674 TGAAGCTCTAAAAGAGACCTTGG + Intergenic
1127818325 15:62632412-62632434 TTTAGTGATCAGAGTGACCTAGG + Intronic
1130560470 15:84954238-84954260 TGAAGCAATCACTGTGACCAGGG + Intergenic
1135768300 16:25196966-25196988 TGAAGGTATCAGTGTGAGTTGGG - Intergenic
1136455433 16:30377531-30377553 TGAAGGAAGTAGAGTGACCTGGG + Intronic
1137467301 16:48721591-48721613 TGTAGCTGTCAGTGTGGCCTGGG + Intergenic
1142331792 16:89459275-89459297 TGAAGCCAGCAGAGAGAGCTTGG + Intronic
1142782540 17:2192326-2192348 TGGAACTATCAGAGTTCCCTTGG + Intronic
1146921547 17:36716122-36716144 TGATGCTGTCAGAGAGAGCTTGG + Intergenic
1148521462 17:48279920-48279942 TGAAGATAGCAAAGGGACCTTGG - Intronic
1148637372 17:49159032-49159054 AGAAGCTGTCAGGGTGACCTAGG - Exonic
1153325230 18:3811821-3811843 TGAAGCTATGAGAGTAGCCCAGG + Intronic
1153759952 18:8320836-8320858 TCTAGCTAGCAAAGTGACCTTGG - Intronic
1157652158 18:49344300-49344322 TGAAGCCATCACAGAGACTTAGG - Intronic
1158409741 18:57194971-57194993 TGAAGCTAACTGTGTGGCCTTGG + Intergenic
1164606835 19:29605716-29605738 TGAAACTATCAAAGGGACCCAGG + Exonic
1164622852 19:29707582-29707604 TGAAGATACCAGGGTGTCCTGGG - Intronic
1164780544 19:30888147-30888169 TGAATCTACAAGGGTGACCTGGG + Intergenic
930596235 2:53391514-53391536 TGAAGGAATCAGAGAGACCGAGG - Intergenic
941005478 2:160242994-160243016 TGAAGCAGTCAGAATGACCTTGG + Intronic
941872445 2:170399982-170400004 TGAAGCAAGCAGAATGACGTGGG - Intronic
941957428 2:171219027-171219049 TGAATCTATCATTGTGATCTTGG - Intronic
942898586 2:181088056-181088078 TTAAGAAATCAGAGTGACCATGG - Intergenic
948735185 2:239999058-239999080 GGAAGCTACCAAAGTGAACTTGG + Intronic
1170800723 20:19587931-19587953 TCAAATTATCACAGTGACCTAGG - Intronic
1170834052 20:19868672-19868694 GGAGGCTGTCAGAGGGACCTTGG + Intergenic
1173878855 20:46395313-46395335 GTAAGCTATCAGAGTTGCCTAGG - Intronic
1178072707 21:28986840-28986862 GGAACATCTCAGAGTGACCTAGG - Exonic
1180594945 22:16966999-16967021 TGAAGCTATCAGAGTGACCTTGG + Intronic
1180717532 22:17881978-17882000 GGAAGGTATCAGAGAGGCCTGGG - Intronic
1184386617 22:44180189-44180211 TGAAGCTCTAAGAGGGGCCTCGG - Intronic
952753360 3:36843716-36843738 TGAAGGAATCAGAGACACCTAGG + Intronic
953990864 3:47482352-47482374 TTCAGTTCTCAGAGTGACCTTGG - Intergenic
954431397 3:50472702-50472724 TGTACCCATCAGAGTGACCTGGG + Intronic
957390135 3:79554510-79554532 TCAAGTAATCAAAGTGACCTTGG + Intronic
959639439 3:108615875-108615897 AGAAGGTATGAGAGTGAACTGGG + Intronic
961639738 3:128357723-128357745 TGAAGCTGTCACAGTCACCCGGG - Intronic
962970646 3:140398679-140398701 TTATGCTGTCAAAGTGACCTTGG + Intronic
964760341 3:160129650-160129672 TGAAGCAATGAGTGTGACATTGG + Intergenic
970013760 4:11489564-11489586 AGAATCTATCAGAGTCACATAGG + Intergenic
972385428 4:38561037-38561059 TGAAGCTTGCATAGTCACCTGGG + Intergenic
975964439 4:79953357-79953379 TCAAGCTCTCAGAATGATCTGGG + Intronic
976269636 4:83218013-83218035 TGAAGCTCTCAAAGGGACCTTGG + Intergenic
977117397 4:93047844-93047866 TTAAGTCATCAGAGTGACCTAGG - Intronic
980766728 4:137315848-137315870 TGAAAATTTCAGAGTGAGCTTGG + Intergenic
983751867 4:171283940-171283962 TGAAGCTCTCATATTGATCTTGG + Intergenic
984448349 4:179867406-179867428 TGAACCTATCACGGTGTCCTTGG + Intergenic
985359090 4:189153346-189153368 TGAAGCTATGGGAGTGGCATTGG + Intergenic
988703199 5:33696850-33696872 TGAAGCTATTATAGTCTCCTAGG + Intronic
990640795 5:57781513-57781535 TAGAGCTATCAGAGAGACCTTGG - Intergenic
992450422 5:76871123-76871145 TGATGCTACCAGAGTGAGGTTGG - Intronic
994766812 5:103928689-103928711 TGAAGCTATCAGACTGAAACAGG - Intergenic
995561317 5:113384786-113384808 TGAAGCCATCAGACAGAACTGGG + Intronic
995861847 5:116649087-116649109 TTAAGGCATCAGTGTGACCTGGG - Intergenic
996092105 5:119361595-119361617 TAAAGCTATCAGAGCCACGTAGG - Intronic
999058144 5:148603949-148603971 TATAGATATCAGATTGACCTAGG - Intronic
999197441 5:149792064-149792086 TGAAGAGAACAGAGTGGCCTGGG + Intronic
1000463501 5:161548681-161548703 TCATGCCATCTGAGTGACCTTGG - Intronic
1000829482 5:166085294-166085316 AGAAGCTACCACAGGGACCTTGG + Intergenic
1002261604 5:177997086-177997108 TTAAACTGTCAGAGTGTCCTGGG - Intergenic
1006622114 6:35372788-35372810 TGACCCTATCTCAGTGACCTTGG + Intronic
1007305006 6:40897073-40897095 TGAAGCCAGGAGAGAGACCTGGG - Intergenic
1008895530 6:56549916-56549938 TGACACTATCCGTGTGACCTTGG + Intronic
1011001468 6:82592512-82592534 TCAAGCTATGAGAATGGCCTGGG - Intergenic
1011028269 6:82893440-82893462 TGAAAGTATCACAATGACCTAGG - Intronic
1011262245 6:85481914-85481936 GGAAGCTGTCACAGTAACCTAGG + Intronic
1017890972 6:158639175-158639197 GGTAGAAATCAGAGTGACCTAGG - Intronic
1018427633 6:163698035-163698057 TGCAGCTGTCAGGGTTACCTTGG - Intergenic
1020218277 7:6212813-6212835 TGAAGCCATCAGAGTGTTCATGG - Intronic
1021067480 7:16194969-16194991 GGAACCTATCAGAATGATCTGGG - Intronic
1022460736 7:30603586-30603608 AGATGTTATCAGAGTAACCTAGG + Intronic
1023821237 7:43981752-43981774 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1029749507 7:102535176-102535198 TGAAGCCACCAGAGGGAACTGGG - Intergenic
1029767454 7:102634279-102634301 TGAAGCCACCAGAGGGAACTGGG - Intronic
1030091024 7:105858689-105858711 TGAAGCACTCAGAATCACCTGGG + Intronic
1030210322 7:106989556-106989578 TGAAGGAATCAGAGAGACCGAGG + Intergenic
1030767717 7:113431948-113431970 TGAAGCTATCAGAAACACCCAGG + Intergenic
1031538184 7:122960489-122960511 TTGAGATATCAGAGTTACCTTGG - Intergenic
1033781310 7:144672734-144672756 TCAAGCCATCGGAGTGCCCTTGG - Intronic
1037916687 8:22777382-22777404 CTAAGCTGTGAGAGTGACCTGGG + Intronic
1041153252 8:54957805-54957827 TGAAGCTATAAGACTTACCAGGG - Intergenic
1042192739 8:66204316-66204338 TGAAGCTATTACAGGTACCTGGG - Intergenic
1044807593 8:96023797-96023819 TGAACCTATCAGTGTGACTAGGG - Intergenic
1046044705 8:108949825-108949847 GGAGGCAATCAGACTGACCTGGG - Intergenic
1048487781 8:134864920-134864942 TAAAGCTCCCAGAATGACCTTGG + Intergenic
1048516733 8:135117966-135117988 TGTAGGGATCAGAGTGATCTAGG + Intergenic
1051347759 9:16168067-16168089 TGAAGCTGCCACAGTGGCCTGGG - Intergenic
1053013927 9:34651217-34651239 TATGGCTCTCAGAGTGACCTGGG + Exonic
1055480024 9:76700483-76700505 AGAAGCTAGCTGAGTGAACTGGG - Intronic
1060276799 9:122188602-122188624 TCAGGCCAACAGAGTGACCTTGG + Intronic
1060708951 9:125836640-125836662 AGTAGCTATAAGAGTGACATTGG + Intronic
1187927855 X:24266484-24266506 AATAGCTATCAGAGTGACTTTGG + Intergenic
1188313491 X:28645924-28645946 TGAAGCTCTTAAAGTGGCCTTGG + Intronic
1189679854 X:43504733-43504755 TGAAGCTTTCAGACTGGCATAGG + Intergenic
1191753523 X:64569367-64569389 AAAAACTATCAGAGTGAACTGGG - Intergenic
1196110705 X:111944133-111944155 TGTAGCTAACAGTGTGACCTTGG - Intronic
1197660847 X:129169526-129169548 TCAAGCTTTCAGAATTACCTGGG + Intergenic
1198934471 X:141891805-141891827 TGAACCTATCAGAGTGGCAAAGG - Intronic
1199590977 X:149468231-149468253 TGACCCCATCTGAGTGACCTTGG - Intergenic
1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG + Intergenic
1201278595 Y:12321417-12321439 TTAAGGAATCAGAGAGACCTAGG - Intergenic
1201358653 Y:13122275-13122297 TTAAGGAATCAGAGAGACCTAGG - Intergenic