ID: 1180595228

View in Genome Browser
Species Human (GRCh38)
Location 22:16968577-16968599
Sequence GGACACTGTGTGGGTAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180595228_1180595234 -1 Left 1180595228 22:16968577-16968599 CCAGTGTTACCCACACAGTGTCC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1180595234 22:16968599-16968621 CCTCCTGGATGCCTGCCCTCAGG 0: 1
1: 0
2: 1
3: 49
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180595228 Original CRISPR GGACACTGTGTGGGTAACAC TGG (reversed) Intronic
903385521 1:22923830-22923852 AGACACTATGTAAGTAACACTGG + Intergenic
904035764 1:27557739-27557761 GGATACTGTGTGTGCCACACTGG - Intronic
905012451 1:34756613-34756635 GAACACTGTTTGGGAAACACTGG + Intronic
905309699 1:37040910-37040932 GTACACTGTGTGAGTGGCACAGG + Intergenic
908772271 1:67607840-67607862 GGACTCTCTGTGGGTATGACTGG - Intergenic
911227596 1:95324197-95324219 GGACACAGTGGGGCTAATACAGG - Intergenic
914932845 1:151950060-151950082 AGACACTGGCTGGGAAACACAGG - Intergenic
916195733 1:162220403-162220425 GAACAGTGTCTGGGGAACACAGG + Intronic
918529215 1:185499687-185499709 GGACAATACGTGGGTCACACAGG + Intergenic
918589202 1:186221972-186221994 GGGCACAGTGGGAGTAACACTGG + Intergenic
918655799 1:187024657-187024679 GGACACAGGGAGGGGAACACAGG + Intergenic
920350521 1:205335176-205335198 GGACCCTGTGAGGGCAACTCCGG - Intergenic
921065565 1:211620052-211620074 GGGGACTTTGTGGGGAACACAGG + Intergenic
922579929 1:226689360-226689382 GGACACTCTCTGGGAAACAAAGG - Intronic
923454552 1:234152407-234152429 GGACACAGGGAGGGGAACACCGG - Intronic
923544680 1:234915386-234915408 GGACACTGTGTGGGGATCAGAGG - Intergenic
923573341 1:235136238-235136260 GGACTGTGTGTGGGTACCAGAGG + Intronic
924434708 1:244028828-244028850 AGACAATGTGTGGTTAACACAGG - Intergenic
1064223380 10:13460610-13460632 GCACACTGAGTGGGCACCACTGG + Intronic
1067767450 10:49097637-49097659 GGACACAGTCTGTGCAACACAGG + Intronic
1068556584 10:58465351-58465373 GGGCACTGTGGGAGTAAGACTGG - Intergenic
1069156311 10:65034936-65034958 GAACACTTTTTGGGAAACACTGG + Intergenic
1069909323 10:71750033-71750055 GTACACTCTGGGGGTAAAACAGG - Exonic
1071927054 10:90422294-90422316 GGACACAGTGTGGGGAATATCGG - Intergenic
1072608537 10:97002184-97002206 GCACACTGTGTGTGTGACCCCGG - Exonic
1074941189 10:118237157-118237179 GGAAAGTGTGTGGGTCACATGGG + Intergenic
1076045808 10:127293425-127293447 GGACACTGTGGGGCCAGCACCGG + Intronic
1076766913 10:132640832-132640854 GGACACTGTGTGGGGGACACTGG - Intronic
1077491117 11:2861528-2861550 GGACAGTGTGTGGCTATCTCTGG - Intergenic
1081718866 11:45271755-45271777 AGACACAGTGAGGGTAACCCAGG + Intronic
1084602326 11:70153307-70153329 GAACACAGTGTGTGGAACACAGG - Intronic
1087709251 11:101530527-101530549 GGACCCTGGGTGGGCAAGACTGG - Intronic
1089262250 11:117231465-117231487 GGCCACTGTCTGGCTAACAAGGG - Intronic
1093153743 12:15655230-15655252 TTACACTGTGGGGTTAACACAGG - Intronic
1096360805 12:50984494-50984516 TGACACTCTGTGGGCATCACAGG - Intronic
1097593008 12:61594290-61594312 GCACACAGTGAGGGGAACACAGG + Intergenic
1099973943 12:89526433-89526455 GGGCACTGTGTGGAAAACAGTGG - Intergenic
1101964317 12:109271926-109271948 GAATACTGTGTAGGAAACACAGG + Intergenic
1103149463 12:118624289-118624311 GGCAACTCTGTGGGTCACACAGG + Intergenic
1103276831 12:119718812-119718834 GGAACCTGTGTGGGTAAAGCAGG + Exonic
1104350502 12:128041075-128041097 GGCCACTGTGTGGAGAACAGAGG - Intergenic
1104694728 12:130854613-130854635 TCACCCTGTGTGGGTATCACAGG + Intergenic
1106714490 13:32373825-32373847 GGAAACTGTGAGGGAAATACGGG - Intronic
1106794664 13:33192091-33192113 TGCCACTGTGTGCCTAACACCGG - Intronic
1107409848 13:40148444-40148466 GGACCCTGTGTGGGGAAGCCTGG + Intergenic
1109118272 13:58418728-58418750 GGACAATGGGTATGTAACACAGG - Intergenic
1109949706 13:69484343-69484365 GGAAACTGTGTGTGTATCATGGG + Intergenic
1112759952 13:102683887-102683909 GGATACTGTGTGGAAAGCACAGG - Intergenic
1113377742 13:109781311-109781333 GGAAACTGCGGGGTTAACACAGG + Intronic
1117673339 14:58130339-58130361 GCAGACTTTCTGGGTAACACTGG - Intronic
1119309127 14:73631930-73631952 GGACACTGTTTTGGTCCCACGGG - Intergenic
1119891522 14:78186053-78186075 GGACACTGCCTGGCTGACACTGG + Intergenic
1121008336 14:90504747-90504769 GGGCAGTGTGTGGATACCACAGG - Intergenic
1121616363 14:95316318-95316340 GGACCCTGTGAGGGTGGCACAGG + Intronic
1122681069 14:103463549-103463571 GGTGACTGAGTGGGTAGCACAGG - Intronic
1123018890 14:105388385-105388407 GCACACTTTGTGGGGAGCACTGG + Intronic
1125797372 15:42412730-42412752 GGAAACTGGGTGGAAAACACAGG - Intergenic
1129245989 15:74278967-74278989 GGAAACTGTGTGGGAAAGAGAGG + Intronic
1129267255 15:74400360-74400382 GGACTCTGTGTAGGGAACCCTGG + Intergenic
1130161551 15:81406061-81406083 GGAAACTGTGTGGGGTACACAGG + Intergenic
1132488448 16:210551-210573 GGCCACTGTGTGGGTGAACCTGG - Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1138141213 16:54570257-54570279 GGAGACTCTGTGGTTCACACAGG - Intergenic
1146196878 17:30820848-30820870 AGAAACTGTCTGGGAAACACAGG + Intronic
1148108414 17:45131624-45131646 TGGCACTGGGTGGGTTACACAGG - Intronic
1151659627 17:75512017-75512039 GGACACAGGGTGGGTGCCACTGG - Intronic
1154305455 18:13227518-13227540 GGACAGTGAGTGGGTCCCACAGG + Intronic
1159370142 18:67518098-67518120 GGACACTGTGAGGGAAAGAATGG - Intergenic
1161566130 19:5003850-5003872 GGAGACTGTGTGGGGGACAGAGG - Intronic
1167510601 19:49893616-49893638 GGACAGTGTGTGGGTGAAAGGGG + Intronic
926744083 2:16136255-16136277 GGACACTTTGGGAGTAACAGGGG - Intergenic
926862654 2:17325347-17325369 GTACACTCTGTTGGTTACACAGG - Intergenic
928174315 2:29023668-29023690 GGACGCTGTTTTGTTAACACAGG + Intronic
928283351 2:29967757-29967779 GGACAGTCTGAGGGTATCACGGG + Intergenic
933708034 2:85305877-85305899 GGACACAGTGTGGGGCACTCTGG - Intronic
935181048 2:100691539-100691561 GGAAGCTGGGTGGGGAACACTGG - Intergenic
935359011 2:102231954-102231976 GGACACGCTGAGGGTAACATGGG + Intronic
935712925 2:105915003-105915025 AGGCACTGTGTGTGGAACACAGG + Intergenic
938732750 2:134159229-134159251 GGACACTATGTTGGGAATACAGG - Intronic
939263795 2:139845432-139845454 GGACAATGTGTGCAAAACACAGG + Intergenic
940186790 2:150993991-150994013 GGAAAATGTCTGGGTAACCCAGG + Intergenic
946691191 2:222309571-222309593 GCAAACTGTGTGGGTTTCACTGG + Intergenic
948298475 2:236883692-236883714 GGACCCTGTCTGGGTAATTCTGG + Intergenic
1168971479 20:1934051-1934073 GAAAAATGTGTGGATAACACTGG - Intronic
1170675029 20:18471126-18471148 GGACTCAGTGTGGGAAACCCAGG - Intronic
1170850938 20:20003961-20003983 GCACAGTGTGTGTGGAACACAGG + Intergenic
1173078707 20:39845710-39845732 GGCCACTGTGTAGGTAAAAATGG + Intergenic
1173772950 20:45679384-45679406 GGACACTCTTTAGGTAACAGTGG + Intergenic
1176802504 21:13445355-13445377 GGATACTGTGTGGTTGGCACTGG - Intergenic
1179502446 21:41818678-41818700 TGACAGTGTGTTGGAAACACAGG - Intronic
1180198042 21:46208991-46209013 GGACAGGGTGTGGGAGACACGGG + Intronic
1180595228 22:16968577-16968599 GGACACTGTGTGGGTAACACTGG - Intronic
1180877249 22:19180335-19180357 GGACACTGTGGGGCAAACACAGG - Intronic
1181870338 22:25893289-25893311 GGACACTGTGGGGGTTACAGAGG + Intronic
1185052454 22:48560999-48561021 GTTCCCTGTGTGGGTGACACTGG + Intronic
949196577 3:1316827-1316849 GGACAGTGGGTGGGAAAAACTGG - Intronic
951268467 3:20597772-20597794 GGACACTGTGAGAGTGAGACGGG - Intergenic
951707053 3:25553988-25554010 GGAAACAGTGTGGCAAACACAGG - Intronic
952851243 3:37731380-37731402 GGTCTCTGTGTGAATAACACTGG + Intronic
954379031 3:50209897-50209919 GGCCAGTGTGTGGCCAACACTGG - Intronic
954390129 3:50264398-50264420 GCACACAGTGGGGGTACCACAGG - Intergenic
954441771 3:50526070-50526092 GGCCAATGTGGGGGAAACACAGG + Intergenic
954516899 3:51186652-51186674 GCACACAGTGTGGGGAACCCTGG - Intronic
955236703 3:57145664-57145686 GGACACGGAGTGGGTAGGACAGG + Intronic
956499300 3:69864723-69864745 GGTCACTGTGTAGGTCTCACGGG + Intronic
956558590 3:70548788-70548810 GAACACTGTTTGGGCACCACTGG - Intergenic
959140908 3:102485896-102485918 TGACACTATGTGAGTAACATAGG - Intergenic
959154684 3:102652621-102652643 GATAACTGTGTGGGGAACACAGG + Intergenic
959205251 3:103298673-103298695 GGAGAGTGTGTGGGTAGCTCAGG - Intergenic
971198232 4:24489283-24489305 GGACACACTTTGGGAAACACAGG - Intergenic
973616220 4:52681081-52681103 GAACACAATGTGGGCAACACTGG - Intergenic
986152341 5:5139764-5139786 GGACACTGGGTGCGGAAAACCGG - Intergenic
993172050 5:84431431-84431453 GAACACTGTGGGTGTAAGACCGG - Intergenic
994214588 5:97123372-97123394 GGCCACTGGGTGGGAAACACAGG - Intronic
996419581 5:123247516-123247538 GGATACTGTGTTGTTAACATTGG + Intergenic
998498553 5:142612226-142612248 GCACTCTGGGTGTGTAACACTGG - Intronic
998530210 5:142877363-142877385 GGACACAATGTGGTAAACACAGG - Intronic
999101491 5:149029256-149029278 GGACACTGTGTTTGTAAAAGTGG + Intronic
1005994315 6:30922279-30922301 GGACAAGGTTTGGGGAACACTGG - Intronic
1009589106 6:65643188-65643210 GGACACAGTGGGAGTAAGACTGG + Intronic
1014236480 6:118962094-118962116 GACCACAGTTTGGGTAACACTGG - Intronic
1015104464 6:129519968-129519990 GGACACTGAGTGGGATAAACAGG + Intergenic
1015813568 6:137185382-137185404 AGACAGTTTGTGGGTAACAGTGG - Intergenic
1016545776 6:145221822-145221844 GGACACAGAGAGGGGAACACCGG + Intergenic
1016935153 6:149444185-149444207 TGACACTGGGTGGCTGACACTGG - Intergenic
1017710428 6:157162802-157162824 GCACACTGTGGGGGTGACCCTGG - Intronic
1017721921 6:157249500-157249522 GGACCCTGTCTGGGTATAACAGG - Intergenic
1018722512 6:166583545-166583567 GGACAGTGGGTGGGGAACCCTGG - Intronic
1018750850 6:166803714-166803736 GGCGACTGTGTGAATAACACAGG - Intronic
1019475756 7:1243335-1243357 TGACCCCGTCTGGGTAACACTGG + Intergenic
1019922492 7:4171900-4171922 GCACACCGTGGGGGGAACACAGG + Intronic
1020521230 7:9189829-9189851 AGACAGTGTGTGGTTAACATAGG + Intergenic
1027050388 7:75018009-75018031 TGACAATGTGTGGGTGACAAAGG - Exonic
1027979842 7:85203550-85203572 GGAAACTGTGTGGGTAGAAGAGG + Intergenic
1032361425 7:131258986-131259008 GGAGAATGTGAGGGTAACAGGGG + Intronic
1035719719 8:1782967-1782989 GACCAATGTGTGGGTGACACTGG - Exonic
1035873658 8:3163693-3163715 GGGCACTGCGTGAGTCACACTGG - Intronic
1037256909 8:16965625-16965647 GGACCCTGTGTGGGTGGAACAGG - Intergenic
1039446303 8:37635924-37635946 GGACAGTGTGTTCGTAAGACAGG + Intergenic
1039582551 8:38678690-38678712 GTACACTGTGTGGTGAACAACGG - Intergenic
1041851651 8:62399935-62399957 GGAGACAGTGTGGATGACACAGG + Intronic
1043789611 8:84447695-84447717 GGACACTTTGTGGGAAGCTCAGG + Intronic
1045692829 8:104777111-104777133 TGACATCGTGTGGGAAACACAGG + Intronic
1048428128 8:134341525-134341547 GGGCACTGTGATGGCAACACAGG - Intergenic
1049488271 8:142877594-142877616 GGACACTGTGTGGGTGAGGTGGG - Intronic
1049493160 8:142915618-142915640 GGACACTGTGTGGGTGAGGTGGG - Intronic
1050265528 9:3885455-3885477 TCACAGTGTGTGGGTAATACCGG - Intronic
1050336374 9:4593869-4593891 GGACCCTGTGTGTGTGGCACAGG - Intronic
1056903919 9:90628214-90628236 TGGCACTGTGTGGGCAGCACAGG - Intronic
1058342858 9:103920082-103920104 GGACACTGTGGGAGTGAGACTGG + Intergenic
1059520044 9:114932468-114932490 GGACAGTGAGTGGGTAGCAAGGG + Intergenic
1061872015 9:133526136-133526158 GGACACTGTGCTGGTTACAAAGG - Intronic
1186713898 X:12230094-12230116 GGACAGTCTGTGGGTAAAACAGG - Intronic
1190062604 X:47220740-47220762 GGCCTGAGTGTGGGTAACACTGG + Intronic
1192157338 X:68756487-68756509 AGACCCTGTTTGGGAAACACTGG - Intergenic
1199802924 X:151269209-151269231 GCACCATGTGTGGTTAACACGGG + Intergenic
1200232841 X:154453011-154453033 GGGCACTGTGTGGGCAAGGCTGG - Intergenic