ID: 1180595230

View in Genome Browser
Species Human (GRCh38)
Location 22:16968586-16968608
Sequence ATCCAGGAGGGACACTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 1, 1: 0, 2: 4, 3: 96, 4: 1074}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180595230_1180595234 -10 Left 1180595230 22:16968586-16968608 CCCACACAGTGTCCCTCCTGGAT 0: 1
1: 0
2: 4
3: 96
4: 1074
Right 1180595234 22:16968599-16968621 CCTCCTGGATGCCTGCCCTCAGG 0: 1
1: 0
2: 1
3: 49
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180595230 Original CRISPR ATCCAGGAGGGACACTGTGT GGG (reversed) Intronic
900822749 1:4901805-4901827 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
901124658 1:6920537-6920559 CCCCAGTAGGGACTCTGTGTGGG + Intronic
901127598 1:6940576-6940598 CCCCAGGAGGGACTCTGTGATGG - Intronic
901767366 1:11511730-11511752 GCCCAGTAGGGACTCTGTGTGGG + Intronic
902271274 1:15306885-15306907 CCCCAGTAGGGACTCTGTGTGGG - Intronic
902570618 1:17344881-17344903 TCCCAGTAGGGACTCTGTGTGGG - Intronic
903146532 1:21376287-21376309 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
903278533 1:22236816-22236838 GTCCAGGAAGGACAGTGCGTGGG + Intergenic
903539701 1:24090028-24090050 ATACAGGAGGCCCAGTGTGTGGG + Intronic
904159084 1:28509245-28509267 GGCCAGAAGGCACACTGTGTTGG + Intronic
904386130 1:30143355-30143377 CCCCAGAAGGGACTCTGTGTGGG + Intergenic
904539928 1:31225893-31225915 ATGCTGGTGGGACACTGGGTGGG + Intronic
905379815 1:37553968-37553990 GTCCAGGATGGACATTGGGTTGG - Intronic
906372960 1:45270019-45270041 CCCCAGTAGGGACTCTGTGTGGG - Intronic
906760453 1:48372616-48372638 CCCCAGTAGGGACTCTGTGTGGG + Intronic
906770082 1:48475788-48475810 CCCCAGTAGGGACACTGTATGGG - Intergenic
906937334 1:50225802-50225824 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
906992678 1:50755593-50755615 GCCCAGTAGGGACTCTGTGTGGG + Intronic
907439278 1:54468865-54468887 CCCCAGTAGGGACACTGTGTGGG - Intergenic
907625100 1:56022154-56022176 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
907685768 1:56609726-56609748 TCCCAGTAGGGACTCTGTGTGGG + Intronic
907890957 1:58636068-58636090 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
908047316 1:60184705-60184727 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
908118665 1:60965364-60965386 CTCCAGTAGGGACTCTGTGTAGG + Intronic
908624762 1:66028022-66028044 CCCCAGTAGGGACTCTGTGTGGG + Intronic
908627212 1:66058421-66058443 CCCCAGTAGGGACTCTGTGTGGG + Intronic
908699335 1:66881217-66881239 CCCCAGTAGGGACTCTGTGTGGG - Intronic
908967826 1:69787377-69787399 CCCAAGGAGGGACTCTGTGTGGG + Intronic
909057054 1:70833778-70833800 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
909057982 1:70845260-70845282 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
909063463 1:70905290-70905312 TCCCAGTAGGGACACTGTGTGGG - Intronic
909065547 1:70931410-70931432 CCCCAGTAGGGACTCTGTGTGGG + Intronic
909096132 1:71291079-71291101 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
909105216 1:71398181-71398203 TCCCAGTAGGGACTCTGTGTGGG - Exonic
909185343 1:72479936-72479958 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
909241663 1:73221607-73221629 CCCCAGTAGAGACACTGTGTGGG + Intergenic
909271566 1:73628930-73628952 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
909599779 1:77449069-77449091 CCCCAGTAGGGACTCTGTGTAGG - Intronic
909632907 1:77785912-77785934 CCCCAGTAGGGACTCTGTGTGGG + Intronic
910001736 1:82350114-82350136 CCCCAGGAGGGACCCTGTGTGGG + Intergenic
910083550 1:83371659-83371681 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
910233191 1:85007904-85007926 CCCCAGTAGGGACTCTGTGTGGG + Intronic
911490796 1:98563389-98563411 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
911500545 1:98679965-98679987 CCCCAGTAGGGACTCTGTGTGGG + Intronic
911741057 1:101387135-101387157 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
911855690 1:102872303-102872325 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
911880838 1:103236559-103236581 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
911985453 1:104616663-104616685 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
912080658 1:105932183-105932205 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
912579113 1:110704435-110704457 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
912610158 1:111034503-111034525 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
912907057 1:113718481-113718503 CCCCAGTAGGGACGCTGTGTGGG + Intronic
913018588 1:114764269-114764291 GTCCAGTGGGGACTCTGTGTGGG - Intergenic
913459028 1:119063903-119063925 CCCCAGTAGGTACACTGTGTGGG - Intronic
914230550 1:145761713-145761735 CCCCAGTAGGGACTCTGTGTGGG - Intronic
915058407 1:153158640-153158662 CCCCAGTTGGGACACTGTGTGGG + Intergenic
915828337 1:159102412-159102434 CCCCAGTAGGGACTCTGTGTGGG - Intronic
916411479 1:164551091-164551113 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
916466638 1:165079997-165080019 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
916649291 1:166819899-166819921 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
916959250 1:169872497-169872519 CTCCAGTAGGAACTCTGTGTGGG - Intronic
916980317 1:170128895-170128917 ATCGAGGAGGGGCTCTGTTTGGG + Intergenic
916999409 1:170340140-170340162 ATCCACGAGGGTCCCTGTCTTGG + Intergenic
917894576 1:179475213-179475235 CTCCAGTAGGGACTCTGTGTGGG - Intronic
918049163 1:180959444-180959466 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
918668101 1:187177692-187177714 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
918831548 1:189405214-189405236 CACCAGTAGGGACTCTGTGTGGG + Intergenic
918886208 1:190197859-190197881 TTCCAGTAGGGACTCTGTGTGGG + Intronic
918969693 1:191397944-191397966 CTCCAGTAGGGACTCTGAGTGGG - Intergenic
919006948 1:191910148-191910170 GTCCAGTGGGGACTCTGTGTGGG + Intergenic
919256236 1:195128528-195128550 CTCCAGGAGGGACTCTGTGTGGG + Intergenic
919291904 1:195643545-195643567 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
919409666 1:197227738-197227760 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
919460524 1:197871918-197871940 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
919554272 1:199031506-199031528 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
920581418 1:207111586-207111608 ATCTTGGAGAGAAACTGTGTGGG - Intronic
920597964 1:207291991-207292013 CTCCAGTAGGAACTCTGTGTGGG - Intergenic
920668706 1:207986390-207986412 ACCCAGCATGGACACTGGGTTGG + Intergenic
920860289 1:209700149-209700171 CCCCAGTAGGGACTCTGTGTTGG + Intronic
920895905 1:210049222-210049244 CCCCAGTAGGGACTCTGTGTGGG + Intronic
921000612 1:211039394-211039416 CCCCAGTAGGGACTCTGTGTGGG - Intronic
921371839 1:214431656-214431678 ATTCTGGAGCTACACTGTGTAGG + Intronic
921466375 1:215492809-215492831 CTCCACTAGGGACTCTGTGTGGG - Intergenic
921594320 1:217038167-217038189 CCCCAGAAGGGACTCTGTGTGGG + Intronic
921610426 1:217206745-217206767 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
921765989 1:218973193-218973215 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
921792741 1:219308845-219308867 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
922058372 1:222063596-222063618 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
922164122 1:223100785-223100807 CTTCAGGAGGGACTCTCTGTGGG - Intergenic
922530495 1:226341477-226341499 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
923297860 1:232612279-232612301 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
923687408 1:236162887-236162909 CCCCAGTAGGGACTCTGTGTGGG - Intronic
923876828 1:238058609-238058631 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
923919313 1:238545970-238545992 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
923997003 1:239506629-239506651 CCCCAGTAGGGACTCTGTGTGGG - Intronic
924040538 1:239979999-239980021 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
924050846 1:240078382-240078404 CCCCAGTAGGGACTCTGTGTGGG - Intronic
924152407 1:241142300-241142322 CCCCAGTAGGGACTCTGTGTGGG + Intronic
924792942 1:247269849-247269871 ACCCAGAGGGGACTCTGTGTGGG + Intergenic
924806621 1:247366594-247366616 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1063037477 10:2301299-2301321 ATCCAGGATGGCCAATATGTTGG + Intergenic
1063992398 10:11580140-11580162 ATCCATGAGGGACATGGTCTGGG - Intronic
1065388756 10:25160203-25160225 ATTCAGGAGGCAAAGTGTGTTGG + Intergenic
1066040741 10:31546153-31546175 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1066062468 10:31736340-31736362 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1066451890 10:35537353-35537375 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1066998757 10:42586953-42586975 ATCCAGTAGGGACAAGGTCTCGG + Intronic
1067545197 10:47187880-47187902 AGGCAGGAGGGCCAGTGTGTGGG + Intergenic
1067814725 10:49464949-49464971 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1067922783 10:50476992-50477014 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1067956304 10:50795248-50795270 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1068312205 10:55292949-55292971 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1068676804 10:59777500-59777522 CCCCAGGAGGGACTCTGTGTGGG + Intergenic
1068908315 10:62351662-62351684 CCCCAGTAGGGACTCTGTGTTGG + Intergenic
1068960444 10:62861894-62861916 ATCCATTAGGGCCACTGTATAGG + Intronic
1069040835 10:63694025-63694047 CCCCAGGAGGGACTCTGTGTTGG - Intergenic
1069070046 10:63983500-63983522 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1069175718 10:65286262-65286284 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1069368029 10:67714114-67714136 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1069730473 10:70608538-70608560 ATACATGAGGGCCACTGCGTGGG + Intergenic
1069805220 10:71118138-71118160 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1070409664 10:76128287-76128309 ATCCAGCAGGAACACTGCGGCGG - Intronic
1070679408 10:78438195-78438217 ATGCAGGAGTGAGGCTGTGTGGG + Intergenic
1071018925 10:81029473-81029495 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1071043041 10:81337317-81337339 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1071395428 10:85218847-85218869 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1071442810 10:85718177-85718199 CCCCAGTAGGGACTCTGTGTAGG + Intronic
1071942037 10:90601094-90601116 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1073926138 10:108518891-108518913 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1074041387 10:109793175-109793197 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1074223655 10:111462399-111462421 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1074262765 10:111870561-111870583 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1074619641 10:115105924-115105946 TTCCAGTAGGGACTCTGTGTGGG - Intronic
1074622315 10:115138328-115138350 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1074965864 10:118490281-118490303 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1075089356 10:119434788-119434810 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1075530524 10:123225273-123225295 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1075826118 10:125358319-125358341 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1075937957 10:126359806-126359828 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1077193365 11:1265641-1265663 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
1077756815 11:5039244-5039266 AATCAGGAGGGAAACTGTGTTGG - Intergenic
1078117334 11:8466706-8466728 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1078339546 11:10488972-10488994 ATCCAAGTGGGAGTCTGTGTTGG - Intronic
1078482244 11:11687675-11687697 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1078496692 11:11824742-11824764 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1078978625 11:16506034-16506056 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1078994743 11:16685756-16685778 CCCCAGTAGGGACTCTGTGTTGG + Intronic
1079143871 11:17833475-17833497 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1079522974 11:21350839-21350861 ATACAGGAGGGACTCTGTACTGG + Intronic
1079686242 11:23363016-23363038 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1079856370 11:25610387-25610409 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1079872910 11:25822454-25822476 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1079925172 11:26484610-26484632 CTCCAGTGGGGACTCTGTGTGGG - Intronic
1080153397 11:29078869-29078891 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1080717559 11:34818795-34818817 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1080817461 11:35772312-35772334 CCCCAGTAGGGACTCTGTGTAGG - Intronic
1080959837 11:37145660-37145682 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1081008125 11:37773881-37773903 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1081022008 11:37958709-37958731 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1081080450 11:38733560-38733582 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1081157811 11:39716347-39716369 CTCCAGTAGGGACTCTATGTGGG - Intergenic
1081325408 11:41738301-41738323 CCCCAAGAGGGACTCTGTGTGGG + Intergenic
1081350468 11:42045476-42045498 ATCCAGGAGATACACTCTGTTGG + Intergenic
1081354436 11:42095409-42095431 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1081400394 11:42636172-42636194 CTCCAGTAGGGACACCGTGTGGG - Intergenic
1081598742 11:44477222-44477244 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1081939464 11:46928465-46928487 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1082268324 11:50143114-50143136 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1082287749 11:50335401-50335423 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1082699491 11:56410056-56410078 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1082782734 11:57300107-57300129 ATCAGGGAAGGACACTGTGGAGG + Intronic
1082934824 11:58645707-58645729 CTCCAGTAGAGACTCTGTGTGGG + Intronic
1083065222 11:59916830-59916852 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1083085076 11:60134414-60134436 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1084537163 11:69764029-69764051 ATGCTGGAGAGACCCTGTGTGGG + Intergenic
1084767987 11:71324887-71324909 GTCCAGGAGGGAGACGGTGGTGG + Intergenic
1085029011 11:73258445-73258467 GTGGAGGAGGGACTCTGTGTAGG - Intergenic
1085651560 11:78273153-78273175 CCCCAGAAGGGACTCTGTGTGGG - Intronic
1085861848 11:80244390-80244412 CCCCAGGAGGGACTCTGTGTGGG - Intergenic
1085875775 11:80404793-80404815 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1085906866 11:80774518-80774540 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1085941803 11:81213971-81213993 CCCCAGGAGGGCCCCTGTGTGGG + Intergenic
1086309354 11:85519128-85519150 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1086580332 11:88391713-88391735 ACCCAGTAGGGACTCTGTCTGGG + Intergenic
1086750748 11:90490389-90490411 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1086769570 11:90745148-90745170 CCCCAGTGGGGACACTGTGTGGG - Intergenic
1086794578 11:91084216-91084238 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1086826711 11:91507746-91507768 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1086995709 11:93353495-93353517 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1087125996 11:94626206-94626228 CCCCAGTAGGGACTCTGTGTCGG + Intergenic
1087341830 11:96916258-96916280 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1087349506 11:97013709-97013731 ATCCAGGACGGACACAGTATAGG - Intergenic
1087433363 11:98081276-98081298 CTCCAGTTGGGACTCTGTGTGGG - Intergenic
1087496265 11:98894097-98894119 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1087511571 11:99101873-99101895 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1087541926 11:99531952-99531974 CCCCAGAAGGGACTCTGTGTGGG - Intronic
1087877499 11:103375352-103375374 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1088377631 11:109159620-109159642 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1088388790 11:109290609-109290631 CTCCAGTGGGGACACTGTGTGGG + Intergenic
1088583088 11:111334246-111334268 ATCCAGGAGGAAAGCTGGGTGGG + Intergenic
1089737558 11:120560444-120560466 ATTCAACGGGGACACTGTGTAGG - Intronic
1091106063 11:132920901-132920923 AGACAGGAGGGACAAGGTGTGGG - Intronic
1091244646 11:134081720-134081742 CCCCAGTAGGGACTCTGTGTAGG - Intronic
1091552918 12:1550427-1550449 ACCCAGTGGGGACTCTGTGTGGG - Intronic
1091912414 12:4243064-4243086 ATGCATGAGGGACTCTGGGTGGG - Intergenic
1092184410 12:6468073-6468095 TTCCAGTGGGGACTCTGTGTGGG - Intronic
1092326307 12:7534810-7534832 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1092662640 12:10755396-10755418 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1094295287 12:28898619-28898641 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1094798443 12:34002347-34002369 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1095039727 12:37427625-37427647 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1095345851 12:41148079-41148101 ACCCAGTGGGGACTCTGTGTGGG + Intergenic
1095413163 12:41946238-41946260 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1097329577 12:58318533-58318555 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1097481058 12:60126425-60126447 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1097609942 12:61807494-61807516 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1097617235 12:61898333-61898355 CTCCAGTGGGGACTCTGTGTAGG + Intronic
1097668809 12:62512712-62512734 CTCCAGTAGGGACTCTGTGTGGG + Intronic
1097700112 12:62811366-62811388 AGCCTGGAGGGACACTGAGCAGG + Intronic
1098061683 12:66569714-66569736 ATCCTGGAGGCACAGAGTGTGGG - Intronic
1098630946 12:72720883-72720905 CCCCAGGAGGGACTCTGTGTAGG - Intergenic
1098661065 12:73094369-73094391 CCCCAGTAGGAACACTGTGTGGG - Intergenic
1098686187 12:73424368-73424390 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1098804751 12:75009687-75009709 ATCCACGAGAGACTCTGGGTAGG - Intergenic
1099004127 12:77216722-77216744 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1099396538 12:82147262-82147284 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1099501481 12:83419175-83419197 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1099507795 12:83500414-83500436 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1099655051 12:85479099-85479121 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1099694253 12:85997915-85997937 CTCCAGTAGGGACTCAGTGTGGG + Intronic
1099846141 12:88031015-88031037 CCCCAGGAGGGACTCTGTGTGGG + Intronic
1100054383 12:90491151-90491173 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1100205518 12:92345218-92345240 CGCCAGTAGGGACTCTGTGTGGG - Intergenic
1100676226 12:96871072-96871094 AACAAGGAGGGAGACAGTGTGGG + Intronic
1100898815 12:99215355-99215377 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1101117795 12:101549126-101549148 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1101257934 12:102998061-102998083 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1101340269 12:103836942-103836964 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1102248854 12:111372178-111372200 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1103175266 12:118858020-118858042 ATCCAGGAGGGAGACAATGGTGG + Intergenic
1103185939 12:118957432-118957454 ATCCAGGAGCTACAATGTGCTGG + Intergenic
1104240506 12:126984685-126984707 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1105406736 13:20138313-20138335 ATCCAGGAAAGACACTGTTATGG + Exonic
1106106634 13:26738794-26738816 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1106262280 13:28078186-28078208 CTTCAGCAGGGACTCTGTGTGGG + Intronic
1106611095 13:31281597-31281619 ATCCAGGAGGGATACTTTTCAGG + Intronic
1106614476 13:31314196-31314218 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1106714493 13:32373834-32373856 AACCGGGAGGGAAACTGTGAGGG - Intronic
1106734823 13:32578177-32578199 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1107535235 13:41323086-41323108 ATCCAGGAGGCACGCTGTGTGGG - Exonic
1107678203 13:42818645-42818667 CGCCAGCAGGGACTCTGTGTGGG + Intergenic
1108042956 13:46356480-46356502 ATTCAGGAGGGACCTTGTGGTGG - Exonic
1108354287 13:49616290-49616312 ATACAGGAAGGACAATGTGGAGG - Intergenic
1108603726 13:52016819-52016841 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1108719619 13:53117725-53117747 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1108790707 13:53966464-53966486 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1109107911 13:58278070-58278092 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1109171949 13:59107784-59107806 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1109286040 13:60409300-60409322 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1109315025 13:60740203-60740225 CTTCAGGAGGGACCCTTTGTGGG + Intergenic
1109344691 13:61100287-61100309 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1109404461 13:61878857-61878879 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1109480390 13:62945051-62945073 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1109522529 13:63532268-63532290 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1109616234 13:64837319-64837341 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1109667571 13:65559035-65559057 CTGCAGTAGGGACTCTGTGTGGG + Intergenic
1109681319 13:65756600-65756622 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1109721105 13:66277447-66277469 CTCCAGTAGGGAGTCTGTGTGGG - Intergenic
1109810742 13:67509547-67509569 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1109810750 13:67509577-67509599 CTCCAGGAGGGACTCTGTGTAGG - Intergenic
1110044437 13:70810749-70810771 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1110377886 13:74814681-74814703 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1110511467 13:76356005-76356027 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1110543163 13:76728167-76728189 CCCCAGTAGGGACACTGTGTGGG - Intergenic
1110649384 13:77925726-77925748 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1110924365 13:81131807-81131829 CCCCAGAAGGGACTCTGTGTGGG - Intergenic
1111105707 13:83642767-83642789 CTCCAGTAGAGACTCTGTGTGGG + Intergenic
1111241634 13:85482335-85482357 CCCCAGTGGGGACACTGTGTGGG + Intergenic
1111301510 13:86356464-86356486 GTACAGGAAGGACACTGTGGAGG + Intergenic
1111358800 13:87146445-87146467 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1111364602 13:87225265-87225287 ATGCAGGAGGGACACAGAGGTGG - Intergenic
1111527589 13:89492334-89492356 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1111609521 13:90584913-90584935 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1111715774 13:91877207-91877229 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1111770027 13:92585084-92585106 CCCCAGGAGGGACTCTGTGTGGG - Intronic
1111889909 13:94068997-94069019 TCCCAGTAGGGACTCTGTGTGGG + Intronic
1112101828 13:96197900-96197922 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1112430446 13:99346198-99346220 ATCAAGGAGGGAGACTCTTTGGG - Intronic
1112534627 13:100239926-100239948 ATCCAGGAGAGACTCAGTTTTGG - Intronic
1112693229 13:101918125-101918147 ATCCAGGAGGGAACCGCTGTCGG - Intronic
1112744236 13:102508944-102508966 ACCCAGTGGGGACTCTGTGTGGG - Intergenic
1112887632 13:104193698-104193720 CCCCAGTAGGGACTCTGTGTCGG - Intergenic
1113008545 13:105736640-105736662 ATCCAGGAAAGACACTATTTAGG - Intergenic
1113252783 13:108472530-108472552 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
1113609722 13:111635541-111635563 AACCAGGAGGAAGACCGTGTTGG - Intronic
1114171098 14:20273211-20273233 GTCCTGGGGGGACCCTGTGTGGG - Intronic
1114217120 14:20665305-20665327 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1114433013 14:22678648-22678670 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1114687542 14:24548277-24548299 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1115115919 14:29880549-29880571 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1115820339 14:37206513-37206535 CTCCAGTAGGGACTTTGTGTGGG - Intronic
1116133510 14:40891129-40891151 CCCTAGTAGGGACACTGTGTGGG + Intergenic
1116195136 14:41715825-41715847 CTCCAGTAGGGACTCTGTGTGGG + Intronic
1116275267 14:42824549-42824571 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1116293528 14:43074152-43074174 CCCCAGTAGGGACGCTGTGTGGG - Intergenic
1116303497 14:43217427-43217449 CCCCAGGAGGGACTCTTTGTCGG + Intergenic
1116420113 14:44722562-44722584 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1116762122 14:49027250-49027272 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1117186314 14:53244049-53244071 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1117751646 14:58930021-58930043 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
1118070919 14:62245897-62245919 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1118431877 14:65727233-65727255 TCCCAGTAGGGACTCTGTGTGGG + Intronic
1118533022 14:66728308-66728330 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1118657470 14:67967861-67967883 TCCCAGAAGGGACTCTGTGTGGG + Intronic
1119200578 14:72748982-72749004 CCCCAGGTGGGACTCTGTGTGGG - Intronic
1119771556 14:77223345-77223367 ATCCTGGCTGGACACTGTGGGGG - Intronic
1120060710 14:79978935-79978957 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1120091103 14:80334168-80334190 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1120103943 14:80473527-80473549 CCCCAGTGGGGACACTGTGTGGG + Intergenic
1120247890 14:82027588-82027610 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1120392843 14:83929973-83929995 TTCCAGTAGGTACTCTGTGTTGG - Intergenic
1120393926 14:83944162-83944184 CCCCAGTAGGGACTCTGTGTTGG + Intergenic
1120407136 14:84103907-84103929 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1120454686 14:84716672-84716694 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1120457799 14:84754674-84754696 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
1120481403 14:85054008-85054030 CCCCAGTGGGGACACTGTGTGGG + Intergenic
1120575351 14:86174728-86174750 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1120692295 14:87606102-87606124 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1120921041 14:89755690-89755712 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1120947588 14:90012681-90012703 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1121147040 14:91593230-91593252 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1121881913 14:97508347-97508369 CTCCAGTAGGGACTCTGTGTAGG - Intergenic
1122421258 14:101578972-101578994 ACTCAGGTGGGACACTGTCTGGG - Intergenic
1123128152 14:105964541-105964563 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1123197364 14:106629465-106629487 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1123705409 15:22947533-22947555 CTCCAGGAGGGTCACAGTATGGG + Intronic
1124664581 15:31581399-31581421 CCCCAGTAGGGACTCTGTGTAGG + Intronic
1125273957 15:37971044-37971066 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1125279302 15:38027063-38027085 CCCCAGGAGGGACTCTGTGTGGG - Intergenic
1125304192 15:38291444-38291466 CCCCAGTAGGGACTCTGTGTCGG + Intronic
1125881414 15:43199110-43199132 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1126126423 15:45298294-45298316 ACCCAGTAGGGACTCTGTGGGGG - Intergenic
1126411509 15:48377123-48377145 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1126539294 15:49804266-49804288 TCCCAGTAGGGACTCTGTGTAGG + Intergenic
1126648040 15:50894664-50894686 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
1127144981 15:56014532-56014554 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1127679026 15:61274881-61274903 ATCCAGGAGGGAAACTTAGAAGG + Intergenic
1127955231 15:63847380-63847402 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1128137690 15:65276084-65276106 ATGCAGCAGGGACCCTGTCTGGG - Intronic
1129469481 15:75742836-75742858 CCCCAGGAGGGACTCTGTGGGGG - Intergenic
1129868298 15:78925293-78925315 AGCCAGGAGGGACAGTGGGGAGG - Intronic
1130738996 15:86577979-86578001 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1130824758 15:87532690-87532712 CCCCAGGAGGGACTCTGTGTGGG + Intergenic
1131752606 15:95526004-95526026 CTCCAGTAGGGACACTGTGTGGG + Intergenic
1132261528 15:100429314-100429336 GTCCAGGAGGGAAACTCTGGAGG + Intronic
1132351108 15:101140361-101140383 CTCCAGGTGGGACACTGGCTTGG - Intergenic
1134056297 16:11171751-11171773 ATGCAGAAGTGTCACTGTGTGGG - Intronic
1134476110 16:14575185-14575207 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1135822715 16:25698398-25698420 ATCAAGAAAGGACACTCTGTAGG - Intronic
1137494405 16:48958673-48958695 GACCAGGAGGGCCACTGTGTGGG - Intergenic
1137981623 16:53074860-53074882 TCCCAGTAGGGACTCTGTGTGGG - Intronic
1138024729 16:53513434-53513456 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1138805650 16:60085910-60085932 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1139381847 16:66537402-66537424 AGCCAGGAGGGACACTGGACAGG + Intronic
1139812737 16:69636412-69636434 ACCCAGTACGGACTCTGTGTGGG + Intronic
1143838709 17:9713626-9713648 ATCCAGGTGGGAGACAGTGGTGG + Intronic
1145358170 17:22182679-22182701 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1145378150 17:22370823-22370845 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1145753689 17:27374234-27374256 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1146164272 17:30575825-30575847 GCCCAGGAGGGGCACTGAGTAGG + Intergenic
1148496870 17:48058327-48058349 CTCCAGGAGGGGCACTGTACAGG - Exonic
1149234067 17:54570318-54570340 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1149260737 17:54877247-54877269 CCCCAGTAGGGACGCTGTGTGGG - Intergenic
1150350145 17:64438044-64438066 CTCCAGTGGGGACTCTGTGTAGG + Intergenic
1150687407 17:67331816-67331838 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1150708239 17:67507798-67507820 ACCCAGGAAGGACACTGAGAAGG - Intronic
1151500953 17:74488584-74488606 CCCCAGTAGGGACCCTGTGTGGG + Intergenic
1152880011 17:82809186-82809208 CTCCAGGAAGGACACTGGGAAGG - Intronic
1152989439 18:349512-349534 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1153812772 18:8766379-8766401 CTGCTGCAGGGACACTGTGTAGG + Intronic
1154032674 18:10767219-10767241 ATTCAGGAGTGACACTGCTTTGG - Intronic
1154313126 18:13282787-13282809 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1155266957 18:24103735-24103757 ATCCAGGAGAAAAACAGTGTTGG - Intronic
1156200186 18:34821865-34821887 ATCCATAAGGGGCACTGTGGTGG + Intronic
1156453843 18:37281803-37281825 ATCCAGGAGGCACCCTGGGGGGG - Intronic
1156583803 18:38409738-38409760 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1156651139 18:39228263-39228285 CTCCAGTAGTGACTCTGTGTGGG - Intergenic
1156817547 18:41328834-41328856 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1156897450 18:42262429-42262451 ATCTAGGCAGGCCACTGTGTGGG + Intergenic
1156898682 18:42275440-42275462 ATGCAGGAGGGAGAATGTGAAGG + Intergenic
1156910757 18:42408857-42408879 CTGCAGTAGGGACTCTGTGTGGG + Intergenic
1156941013 18:42767088-42767110 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1157195086 18:45614377-45614399 CTCCAGTGGGGACTCTGTGTGGG - Intronic
1157377853 18:47182555-47182577 CCCCAGGAGGGACTCTGTGTGGG - Intergenic
1157563931 18:48667183-48667205 ATTCATGATGGAGACTGTGTAGG + Intronic
1157679135 18:49590091-49590113 ATACAAGAGAGACACTGTATTGG - Intronic
1157742167 18:50103133-50103155 AGCCAGGAGGCCCACTTTGTGGG + Intronic
1158071471 18:53475738-53475760 ACCCAGTAGGGACTCTGTGTGGG - Intronic
1158691553 18:59665856-59665878 ACCAAGCAGGAACACTGTGTGGG + Intronic
1159157303 18:64601269-64601291 CTCTAGTAGGGACTCTGTGTGGG + Intergenic
1159410879 18:68073229-68073251 GCCCAGTAGGGACACTGTGTGGG - Intergenic
1159508049 18:69360942-69360964 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1159731616 18:72034525-72034547 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1159751025 18:72302840-72302862 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1159765254 18:72481044-72481066 CTCCAGTAGGTACTCTGTGTGGG - Intergenic
1159767654 18:72509673-72509695 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1159838837 18:73372836-73372858 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1159896014 18:73996696-73996718 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1160185700 18:76674763-76674785 CCCCAGGAGGGACCCTGTGATGG - Intergenic
1160601321 18:80014741-80014763 TCCCAGTAGGGACTCTGTGTGGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162296207 19:9815489-9815511 ACCCAATAGGGACTCTGTGTGGG + Intronic
1165888361 19:39095663-39095685 ACCCAGTAGGGACTCTGTGTGGG + Intronic
1165974754 19:39665950-39665972 CTCCAGTAGGGACTCTGTGTAGG + Intergenic
1166252709 19:41582430-41582452 CCCCAGTAGGGACTCTGTGTCGG + Intronic
1166410064 19:42550743-42550765 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1166624536 19:44338542-44338564 ATGCAGCAGGAACACTATGTAGG - Intronic
1168110084 19:54187296-54187318 AAGCAGGAGGCGCACTGTGTTGG + Intronic
925233001 2:2252474-2252496 ATCCAGGAGGGACTCAGGGATGG + Intronic
925257073 2:2499427-2499449 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
925344382 2:3160204-3160226 AGCAAGGAGGGTCACTGTGGAGG - Intergenic
925415659 2:3668487-3668509 ACCCAGGAGGGAGACGGTGCTGG + Intronic
925724484 2:6859784-6859806 CCCCAGTAGGGACTCTGTGTTGG - Intronic
925805130 2:7641118-7641140 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
925865269 2:8221442-8221464 GTCCAGGAGGGGCACAGTGTGGG - Intergenic
926391683 2:12400314-12400336 ATCCAGGGGTGATACTGTTTGGG + Intergenic
926448490 2:12973368-12973390 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
926465058 2:13177343-13177365 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
926467965 2:13214951-13214973 CCCCAGTATGGACACTGTGTGGG + Intergenic
926508150 2:13741230-13741252 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
926938966 2:18115273-18115295 ACCCAGTAGGGACTCTGTATAGG - Intronic
927033747 2:19150560-19150582 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
927360226 2:22224016-22224038 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
927438191 2:23088536-23088558 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
928465606 2:31519834-31519856 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
928821463 2:35366613-35366635 CTACAGTAGGGACTCTGTGTAGG - Intergenic
928927330 2:36593324-36593346 CCCCAGTAGGGACTCTGTGTGGG + Intronic
929358147 2:41050955-41050977 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
929528792 2:42732134-42732156 CCCCAGTAGGGACTCTGTGTGGG + Intronic
929995224 2:46821753-46821775 ATGAAGGAGGGACACTGGGGAGG - Intronic
930006803 2:46904283-46904305 CCCCAGTAGGGACTCTGTGTGGG - Exonic
930310342 2:49732118-49732140 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
930444332 2:51451274-51451296 TTCCAGTAAGGACTCTGTGTGGG - Intergenic
931272155 2:60712691-60712713 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
931682510 2:64763295-64763317 ATCCAAGAGGGGCACTATGGAGG + Intergenic
931734698 2:65182995-65183017 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
932524026 2:72444457-72444479 CCCCAGTAGGGACTCTGTGTGGG + Intronic
932537695 2:72617342-72617364 TCCCAGTAGGGACTCTGTGTGGG + Intronic
932552451 2:72785364-72785386 CCCCAGTAGGGACTCTGTGTGGG + Intronic
932821606 2:74906297-74906319 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
932904384 2:75733741-75733763 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
932912252 2:75818209-75818231 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
933064155 2:77772929-77772951 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
933268110 2:80203756-80203778 CCCCAGTAGGGACTCTGTGTGGG + Intronic
934610549 2:95732241-95732263 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
934618264 2:95788792-95788814 ATCCCGGAGGGGCAGGGTGTGGG + Intergenic
934642629 2:96035767-96035789 ATCCCGGAGGGGCAGGGTGTGGG - Intronic
935419711 2:102854487-102854509 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
935625945 2:105172419-105172441 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
935704612 2:105845015-105845037 TGCCAGCAGGGACCCTGTGTAGG - Intronic
935798004 2:106664064-106664086 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
936543888 2:113373823-113373845 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
936683786 2:114804340-114804362 ACCCAGTAGGGACTCTGTGTGGG - Intronic
936821817 2:116530635-116530657 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
936915746 2:117637653-117637675 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
936969655 2:118164920-118164942 GTCCAGTAGGGACTCTGTGTGGG - Intergenic
937527538 2:122789037-122789059 GCCCAGTAGGGACTCTGTGTCGG - Intergenic
937761087 2:125604256-125604278 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
937762943 2:125627708-125627730 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
937800634 2:126077098-126077120 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
938422866 2:131157715-131157737 ATCCAGGAGGGGCACTGAACTGG - Intronic
938686356 2:133742061-133742083 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
938868828 2:135452919-135452941 CCCCAGTAGGGACACTGTGTGGG + Intronic
938974127 2:136459163-136459185 TTCCAGTGGGGACTCTGTGTAGG + Intergenic
939137599 2:138315487-138315509 CCCCAGGAGGGACTCTGTGTGGG + Intergenic
939190589 2:138912586-138912608 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
939498261 2:142949322-142949344 TCCCAGTAGGTACACTGTGTGGG + Intronic
939559253 2:143714028-143714050 CCCCAGAAGGGACTCTGTGTGGG + Intronic
939667525 2:144969420-144969442 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
939694919 2:145312127-145312149 ACCCAGTAGGGACTCTGCGTGGG + Intergenic
939728311 2:145751403-145751425 CTACAGGAGGGACACTGTTTTGG - Intergenic
940484119 2:154275683-154275705 GTCCAGGGGGGACTCTGTGTGGG - Intronic
940485230 2:154288937-154288959 GCCCAGGGGGGACTCTGTGTGGG + Intronic
940533084 2:154904756-154904778 CACCAGTAGGGACTCTGTGTGGG + Intergenic
941123760 2:161561798-161561820 CCCCAGGAGGGACTCTGTATGGG - Intronic
941424036 2:165320449-165320471 CCCCAGTAGGGACCCTGTGTTGG + Intronic
941477603 2:165968240-165968262 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
941578773 2:167268765-167268787 CTCCAGTAGGGACTCTGTGAGGG - Intergenic
941682608 2:168414995-168415017 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
941741921 2:169044400-169044422 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
941888412 2:170553154-170553176 CTCCAGTGGGGACTCTGTGTGGG - Intronic
941967305 2:171312716-171312738 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
941977762 2:171424287-171424309 TCCCAGTAGGGACTCTGTGTGGG - Intronic
942123738 2:172803167-172803189 CCCCAGTAGGGACTCTGTGTGGG + Intronic
942283407 2:174390046-174390068 CCCCAGTAGGGACTCTGTGTGGG - Intronic
942319584 2:174724768-174724790 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
942419991 2:175797545-175797567 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
942517960 2:176773301-176773323 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
942649774 2:178154547-178154569 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
942805775 2:179929833-179929855 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
942950112 2:181712395-181712417 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
943205272 2:184886479-184886501 CCCCAGTAGGGACACCGTGTGGG + Intronic
943219855 2:185090714-185090736 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
943223490 2:185139917-185139939 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
943386731 2:187210754-187210776 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
943478162 2:188385074-188385096 CCCCAGTAGGGACTCTGTGTGGG + Intronic
943483987 2:188456668-188456690 CCCCAGTAGGGACTCTGTGTGGG - Intronic
943832915 2:192485413-192485435 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
943871668 2:193008137-193008159 TCCCAGTAGGGACACTGTGTGGG + Intergenic
943998095 2:194797262-194797284 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
944011436 2:194979414-194979436 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
944307435 2:198194279-198194301 CTCCAGGGGGGACTCTGTGTGGG + Intronic
945433812 2:209795918-209795940 CTCCATTAGGGACTCTGTGTGGG - Intronic
945484789 2:210382258-210382280 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
945713497 2:213330156-213330178 CTCCAGTAGGGACTCTGTGTGGG - Intronic
945931021 2:215854847-215854869 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
946574226 2:221057047-221057069 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
946757580 2:222963010-222963032 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
946760564 2:222989275-222989297 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
946930093 2:224662524-224662546 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
947646922 2:231749027-231749049 CCCCAGTAGGGACTCTGTGTGGG - Intronic
947926565 2:233926905-233926927 AACCAGGAGAGACAGTGTGAAGG - Intronic
948689217 2:239691433-239691455 GGCCAGCAGGGACAGTGTGTTGG + Intergenic
948893404 2:240917554-240917576 ATCCAGGAGGCACAAGGTGGGGG + Intergenic
1169165029 20:3415600-3415622 CTCCAGTGGGGACCCTGTGTGGG + Intergenic
1170037542 20:12004879-12004901 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1170079034 20:12450912-12450934 CCCCACTAGGGACACTGTGTGGG - Intergenic
1170310097 20:14982826-14982848 CTCCAGTAGGGACTCTGTGTGGG - Intronic
1170479949 20:16755546-16755568 CTCCAGTAAGGACTCTGTGTGGG + Intronic
1170643850 20:18179303-18179325 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1170875256 20:20244232-20244254 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1171534312 20:25872837-25872859 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1172165532 20:32896757-32896779 ATCCAGGAGCGAGGCGGTGTCGG - Intronic
1172397229 20:34617177-34617199 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1172846025 20:37930436-37930458 AGCCAGGAGGGACAGGGTGGGGG + Intronic
1173164703 20:40679139-40679161 ATCCTGGAGGGACAGCATGTGGG - Intergenic
1173263909 20:41460782-41460804 ACCAAGTAGGGACTCTGTGTGGG - Intronic
1173464225 20:43268418-43268440 ATCCTGGATGTAGACTGTGTTGG - Intergenic
1173711066 20:45156119-45156141 ACCCAGTGGGGACTCTGTGTGGG - Intergenic
1173747321 20:45447847-45447869 TCAGAGGAGGGACACTGTGTAGG - Intergenic
1175008521 20:55710988-55711010 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1175889460 20:62309908-62309930 AGCCAGGCGGGACTCTGGGTGGG - Intronic
1176358640 21:5973959-5973981 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1176704380 21:10101081-10101103 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1177067971 21:16464205-16464227 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1177139717 21:17344888-17344910 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1177169550 21:17640403-17640425 CTCCAGTGGGGACACTGTGTGGG + Intergenic
1177236106 21:18391711-18391733 GCCCAGGGGGGACTCTGTGTGGG + Intronic
1177258202 21:18693022-18693044 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1177317427 21:19479276-19479298 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1177365196 21:20126010-20126032 ATCCAGAAGGCACACTCTTTTGG - Intergenic
1177408355 21:20699162-20699184 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1177529059 21:22337055-22337077 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1177570246 21:22877491-22877513 CTCCAGTAGGGACTCTGTGAGGG + Intergenic
1177594102 21:23213066-23213088 CCCCAGTAGGGACACTGTGCAGG + Intergenic
1177741160 21:25155048-25155070 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1177761063 21:25402576-25402598 CCCCAGTAGGGATACTGTGTGGG - Intergenic
1178221856 21:30669348-30669370 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1178643052 21:34362105-34362127 AGCCAGGAGGAACACTTTGGTGG - Intergenic
1178673411 21:34612182-34612204 TTTCAGGAGGGAAACTGGGTAGG - Intronic
1179065158 21:38017948-38017970 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1179235285 21:39540253-39540275 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1179316392 21:40247783-40247805 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1179764878 21:43564591-43564613 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1179936705 21:44610613-44610635 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1180108667 21:45637405-45637427 CTCCAGGAGAGAGCCTGTGTGGG + Intergenic
1180251420 21:46592604-46592626 CCCCAGGAGGAACTCTGTGTGGG - Intergenic
1180595230 22:16968586-16968608 ATCCAGGAGGGACACTGTGTGGG - Intronic
1182182387 22:28363503-28363525 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1182957706 22:34442774-34442796 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1184311957 22:43651535-43651557 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1184713233 22:46265426-46265448 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
949369399 3:3318265-3318287 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
949665345 3:6332135-6332157 ACCCAGTAAGGACTCTGTGTGGG - Intergenic
950179007 3:10897794-10897816 TCCCAGTAGGGACTCTGTGTAGG + Intronic
950468527 3:13170405-13170427 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
950806082 3:15604097-15604119 CCCCAGGAGGGACTCTGTATGGG + Intronic
950963382 3:17128881-17128903 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
951093056 3:18597850-18597872 TCCCAGCAGGGACCCTGTGTGGG + Intergenic
951199684 3:19863061-19863083 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
951452181 3:22852210-22852232 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
951865163 3:27299507-27299529 CCCCAGCAGGGACTCTGTGTGGG - Intronic
952029140 3:29120048-29120070 ACCCAGTAGGGACTCTGTGTGGG - Intergenic
952096496 3:29960523-29960545 CCCCAGGGGGGACTCTGTGTGGG + Intronic
952105511 3:30065425-30065447 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
952170242 3:30799135-30799157 CCCCAGTAGGGACTCTGTGTGGG + Intronic
952715047 3:36471946-36471968 CCCCAGTAGGGACTCTGTGTGGG + Intronic
953503790 3:43463105-43463127 CTCCAGTAGAGACTCTGTGTGGG - Intronic
955395484 3:58554224-58554246 CTCCAGTGGGGACTCTGTGTAGG + Intergenic
955465229 3:59230241-59230263 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
955833213 3:63026521-63026543 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
956336950 3:68175247-68175269 CCCCAGTAGGGACTCTGTGTTGG - Intronic
956551231 3:70461806-70461828 GCCCAGCAGGGACTCTGTGTGGG - Intergenic
957160268 3:76601316-76601338 CCCCAGTAGGGACCCTGTGTGGG + Intronic
957300583 3:78387600-78387622 CGCCAGTAGGGACTCTGTGTGGG + Intergenic
957403687 3:79749886-79749908 CACCAGTAGGGACTCTGTGTGGG - Intronic
957625234 3:82646773-82646795 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
957662866 3:83183888-83183910 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
957676750 3:83377318-83377340 CTCCAGTTGGGACTCTGTGTGGG + Intergenic
957759238 3:84533362-84533384 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
957945447 3:87057481-87057503 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
957987460 3:87590094-87590116 ACCCAGTGGGGACTCTGTGTGGG + Intergenic
958481646 3:94651973-94651995 CTCCAGGAGGGACTCTGTATGGG - Intergenic
958518662 3:95156264-95156286 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
958577739 3:95974167-95974189 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
958650049 3:96926924-96926946 CCCCAGTAGGGACTCTGTGTGGG + Intronic
958831795 3:99098911-99098933 CTCCAGTAGGGACTCTGTGTAGG - Intergenic
958844866 3:99253761-99253783 TTCCAGTAGGGCCACTATGTGGG + Intergenic
959142761 3:102506044-102506066 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
959317060 3:104822115-104822137 CCCCAGGAGGGACTCTGTTTGGG - Intergenic
959319119 3:104848413-104848435 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
959337027 3:105079551-105079573 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
959624365 3:108432933-108432955 CCCCAGCAGGGACTCTGTGTGGG - Intronic
959785664 3:110294747-110294769 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
959815666 3:110670908-110670930 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
959905025 3:111701884-111701906 ATTCAGGAGAGGCACTTTGTGGG + Intronic
959968428 3:112381692-112381714 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
959973445 3:112432170-112432192 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
960060259 3:113312979-113313001 CCCCAGTAGGGACTCTGTGTGGG - Intronic
960473232 3:118093459-118093481 ACCCAGTGGGGACTCTGTGTAGG - Intergenic
961257815 3:125571868-125571890 CCCCAGTAGGGACTCTGTGTGGG - Intronic
961503789 3:127356691-127356713 CTCCAGTGGGGACTCTGTGTTGG + Intergenic
961789338 3:129364643-129364665 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
962057370 3:131886473-131886495 CCCCAGTAGGGACTCTGTGTGGG - Intronic
962170767 3:133098978-133099000 CTACAGTAGGGACTCTGTGTGGG + Intronic
962659360 3:137585692-137585714 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
962769992 3:138603040-138603062 CCCCAGTAGGGACCCTGTGTGGG - Intergenic
962946239 3:140173524-140173546 CCCCAGTAGGGACTCTGTGTGGG + Intronic
962951933 3:140227583-140227605 CCCCAGGAGGGACTCTGTATGGG + Intronic
963421019 3:145061264-145061286 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
963422057 3:145073207-145073229 TCCCGGTAGGGACACTGTGTGGG + Intergenic
963433710 3:145241755-145241777 CTCCACTGGGGACACTGTGTGGG + Intergenic
963475141 3:145794688-145794710 CTCCAGTAGGGACTCTGTATGGG + Intergenic
963592969 3:147286389-147286411 CCCCAGTAGGGACCCTGTGTGGG + Intergenic
963815964 3:149831167-149831189 CCCCAGTAGGGACTCTGTGTGGG - Intronic
964076657 3:152700641-152700663 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
964340034 3:155698721-155698743 ACCCAGGTGTGACACTTTGTAGG - Intronic
964654583 3:159052253-159052275 CCCCAGTAGGGACTCTGTGTGGG - Intronic
964923453 3:161926626-161926648 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
965108390 3:164388089-164388111 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
965112761 3:164448693-164448715 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
965146550 3:164912779-164912801 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
965275455 3:166676942-166676964 CTCCAGCGGGGACTCTGTGTGGG + Intergenic
965404837 3:168255759-168255781 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
965657546 3:171004500-171004522 ATCCACATGGGACACTTTGTGGG - Intronic
965857211 3:173103292-173103314 ACCCAGTAGGAACTCTGTGTGGG + Intronic
965864089 3:173183521-173183543 CCCCAGAAGGGACTCTGTGTGGG - Intergenic
965897412 3:173594632-173594654 CCCCAGTAGGGACTCTGTGTTGG + Intronic
966115717 3:176458447-176458469 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
967154963 3:186683795-186683817 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
967462270 3:189760711-189760733 CCCCAGTAGGGACTCTGTGTGGG + Intronic
967505229 3:190245981-190246003 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
967566594 3:190980159-190980181 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
967614354 3:191547209-191547231 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
967689563 3:192458220-192458242 CCCCAGTAGGGACTCTGTGTGGG - Intronic
967695710 3:192528570-192528592 CCCCAGTAGGGACCCTGTGTGGG + Intronic
967933560 3:194708273-194708295 CACCAGGAGGGACTCTGTATGGG + Intergenic
968530531 4:1089032-1089054 CCCCAGTTGGGACACTGTGTGGG - Intronic
968532767 4:1103283-1103305 ATTCAGGAGTGACACTATTTAGG - Intronic
968552030 4:1228737-1228759 ACCCAGGAAGGACACTGAGCAGG + Intronic
968749760 4:2382226-2382248 GCCCAGTAGGGACTCTGTGTGGG - Intronic
969059467 4:4423692-4423714 AGACAGGGGGCACACTGTGTCGG + Intronic
969188581 4:5498868-5498890 ATCCAGGAGACACACTGGGCAGG - Intronic
969194657 4:5551112-5551134 CCCCAGTAGGGACTCTGTGTGGG - Intronic
969692097 4:8709393-8709415 ATCCTGGGGGGACTCTGTCTTGG - Intergenic
969933610 4:10658740-10658762 TGACAGAAGGGACACTGTGTCGG - Intronic
970057274 4:11989041-11989063 ATCCAGAAGGGGCCCTGTCTGGG + Intergenic
970099330 4:12502985-12503007 CTCCAGTGGGGACTCTGTGTAGG + Intergenic
970222548 4:13825548-13825570 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
970306078 4:14733952-14733974 CTCCAGTAGGGACTCAGTGTGGG + Intergenic
970554194 4:17215027-17215049 CTGCAGCAGGGACTCTGTGTGGG + Intergenic
970624379 4:17861121-17861143 CCCCAGTAGGGACTCTGTGTGGG + Intronic
970742085 4:19250756-19250778 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
970763297 4:19517208-19517230 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
970801305 4:19976350-19976372 TCCCAGTAGGGACACTGTGTGGG + Intergenic
970868143 4:20782331-20782353 TCCCAGTAGGGACTCTGTGTAGG + Intronic
970977406 4:22057383-22057405 CCCCAGTAGGGATACTGTGTGGG - Intergenic
970987611 4:22176615-22176637 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
971010697 4:22431157-22431179 CCCCAGTAGGGACTCTGTGTGGG - Intronic
971021954 4:22546108-22546130 CCCCAGTTGGGACACTGTGTGGG + Intergenic
971071970 4:23104756-23104778 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
971600207 4:28582331-28582353 CCCCAGAAGGGACTCTGTGTAGG - Intergenic
971687429 4:29787345-29787367 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
972014523 4:34226628-34226650 TCCCAGTAGGGACTCTGTGTTGG - Intergenic
972150819 4:36088512-36088534 ATCCAGAAGGGAGTCTGTGTGGG - Intronic
972237037 4:37146743-37146765 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
972242052 4:37203951-37203973 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
972370524 4:38419287-38419309 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
972582462 4:40406873-40406895 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
972749396 4:41973382-41973404 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
972829874 4:42802588-42802610 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
972849870 4:43035652-43035674 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
973063846 4:45763371-45763393 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
973718407 4:53700280-53700302 CCCCAGTAGGGACTCTGTGTGGG + Intronic
974013061 4:56624870-56624892 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
974037263 4:56827849-56827871 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
974110913 4:57524179-57524201 CTGCAGTAGGGACTCTGTGTGGG - Intergenic
974202238 4:58656914-58656936 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
974214498 4:58827949-58827971 TCCCAGCAGGGACTCTGTGTGGG + Intergenic
974271029 4:59651738-59651760 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
974341112 4:60615995-60616017 CTCCAGTAGGGCCTCTGTGTGGG - Intergenic
974394995 4:61322886-61322908 CCCCAGTAGGGACTCTGTGTGGG + Intronic
974555807 4:63446035-63446057 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
974569665 4:63628296-63628318 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
974587305 4:63896150-63896172 AACCAGTAGGGACTCCGTGTGGG + Intergenic
974679839 4:65146796-65146818 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
974702731 4:65472402-65472424 CCCCAGTGGGGACACTGTGTGGG + Intronic
974748178 4:66103000-66103022 CCCCAGTAGGGACTCTGTGTCGG - Intergenic
974772451 4:66433890-66433912 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
974797126 4:66767035-66767057 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
975040419 4:69739209-69739231 CCCCAGTAGGGACTCTGTGTGGG + Intronic
975279221 4:72540950-72540972 CTCCAGTAGGGACTCTGTGTGGG - Intronic
975506984 4:75148648-75148670 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
975542867 4:75532538-75532560 GCCCAGTAGGGACTCTGTGTGGG + Intronic
975632436 4:76416889-76416911 GCCCAGTAGGGACTCTGTGTGGG - Intronic
975804285 4:78096416-78096438 CCCCAGTAGGGACTCTGTGTGGG + Intronic
976051145 4:81012578-81012600 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
976172455 4:82318230-82318252 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
976405580 4:84657990-84658012 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
976461167 4:85314411-85314433 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
976636002 4:87286986-87287008 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
976672907 4:87673850-87673872 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
977463642 4:97356869-97356891 TCCCAGTAGGGACTCTGTGTGGG + Intronic
977592503 4:98842304-98842326 CCCCAGGAGGGACTCTGTGTGGG - Intergenic
977820986 4:101472382-101472404 CCCCAGTAGGGACTCTGTGTGGG - Intronic
978034512 4:103976726-103976748 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
978654796 4:111052328-111052350 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
978915679 4:114123905-114123927 CTCCAGTAAGGACTCTGTGTAGG + Intergenic
978934117 4:114354822-114354844 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
978939106 4:114415684-114415706 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
979060864 4:116059066-116059088 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
979078421 4:116303830-116303852 TCCCAGTAGGGACTCTGTGTAGG - Intergenic
979125594 4:116968640-116968662 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
979391876 4:120138014-120138036 CCCCAGGAGGGACTCTGTGTGGG + Intergenic
979444905 4:120801200-120801222 ATTCTGCAGGGACACTGTCTTGG - Intronic
979500462 4:121434308-121434330 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
980094058 4:128471712-128471734 ATGCAGGAGGAGGACTGTGTTGG + Intergenic
980310695 4:131125942-131125964 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
980335578 4:131469116-131469138 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
980352403 4:131699529-131699551 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
980646135 4:135644371-135644393 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
980707595 4:136519922-136519944 CTCCAGTGGAGACACTGTGTGGG + Intergenic
980742722 4:136973278-136973300 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
981120966 4:141050880-141050902 CCCCAGTAGGGACTCTGTGTGGG + Intronic
981483349 4:145259883-145259905 CTCCGGTAGGGACTCTGTGTGGG + Intergenic
981643061 4:146967416-146967438 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
981861520 4:149361799-149361821 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
982019684 4:151190797-151190819 CCCCAGTAGGGACTCTGTGTTGG - Intronic
982189046 4:152834804-152834826 GCCCAGTAGGGACTCTGTGTGGG + Intronic
982192970 4:152877081-152877103 CCCCAGTAGGGACTCTGTGTGGG - Intronic
982310028 4:153974931-153974953 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
982392874 4:154884791-154884813 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
982560859 4:156926861-156926883 TCCCAGTAGGGACTCTGTGTGGG + Intronic
983320659 4:166191988-166192010 TTCCAGTAGGGACTCTGTGTGGG - Intergenic
983348656 4:166559428-166559450 CCCCAGTAGGGACACTGTGTGGG - Intergenic
983455093 4:167953339-167953361 AGGCAGTAGGGACTCTGTGTGGG - Intergenic
983478282 4:168242257-168242279 CCCCAGGAGGGACTCTGTGCAGG - Intronic
983723812 4:170893404-170893426 ACCCAGTAGGGATTCTGTGTGGG + Intergenic
983736624 4:171070199-171070221 TTCCAGTGGGGACTCTGTGTAGG + Intergenic
983785935 4:171729424-171729446 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
984026346 4:174547760-174547782 CCCCAGTGGGGACACTGTGTGGG - Intergenic
984234751 4:177142414-177142436 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
984289025 4:177769149-177769171 ATCCAGAGGTGAGACTGTGTGGG + Intronic
984516977 4:180752964-180752986 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
984554962 4:181202615-181202637 AGGCAGGAGGCACGCTGTGTGGG - Intergenic
984900331 4:184580680-184580702 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
985156018 4:186987901-186987923 CTCCAGTAGGGACTCTGTGGGGG + Intergenic
985159987 4:187034315-187034337 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
985201452 4:187489011-187489033 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
985304340 4:188522181-188522203 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
985386392 4:189452502-189452524 CTCCAGGGGGGACTCTGTGAGGG - Intergenic
985538818 5:478496-478518 AGCCAGGAGGGACACTGGGCAGG + Intronic
985809223 5:2070799-2070821 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
985970427 5:3373840-3373862 ATCCTGAAGGGACCCTGTCTTGG - Intergenic
986087169 5:4463150-4463172 ATCCATGAAGGACACGGTGAAGG + Intergenic
986105488 5:4655784-4655806 CCCCAGTAGGGACACTGTGTGGG + Intergenic
986113904 5:4750473-4750495 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
986258684 5:6123785-6123807 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
986397257 5:7343292-7343314 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
986563368 5:9085711-9085733 CCCCAGTAGGGACACTGTGAGGG - Intronic
986640586 5:9868196-9868218 CTCCAGTGGGGACTCTGTGTAGG + Intergenic
986900213 5:12421929-12421951 ACCCAGTGGGGACTCTGTGTGGG - Intergenic
986956941 5:13163432-13163454 ACTCAGGAGGAACACAGTGTGGG - Intergenic
987000093 5:13651588-13651610 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
987097899 5:14566288-14566310 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
987260365 5:16196331-16196353 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
987478935 5:18428618-18428640 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
987509290 5:18815144-18815166 CTCTAGTAGGGACTCTGTGTAGG + Intergenic
987531785 5:19130637-19130659 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
987602061 5:20084529-20084551 ACCCAGTAGGAACTCTGTGTGGG + Intronic
987895636 5:23942953-23942975 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
987984928 5:25134194-25134216 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
987991530 5:25218351-25218373 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
988031784 5:25771929-25771951 CTCCAGTGGGGACCCTGTGTGGG - Intergenic
988149991 5:27364837-27364859 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
988221207 5:28349077-28349099 TTCCAGTAGGGACTCTGTGTGGG + Intergenic
988317032 5:29644124-29644146 CTCCACTAGGGACTCTGTGTGGG - Intergenic
988426822 5:31074172-31074194 CTCTAGTAGGGAAACTGTGTGGG + Intergenic
988473854 5:31565533-31565555 CTCCAGTGGGGACTCTGTGTTGG + Intergenic
988886031 5:35559001-35559023 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
989046973 5:37283085-37283107 CTCCAGTAGGGACTCTATGTGGG + Intergenic
989532590 5:42525057-42525079 CCCCAGCAGGGACTCTGTGTGGG - Intronic
989656744 5:43753280-43753302 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
990092833 5:52075592-52075614 ATTCACCAGTGACACTGTGTGGG + Intronic
990193277 5:53286191-53286213 CCCCAGTAGGGACACTGTGTGGG + Intergenic
990329616 5:54713023-54713045 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
990399618 5:55424967-55424989 ATACAGGTGGGGCACTGTTTTGG + Exonic
990595586 5:57309555-57309577 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
990701044 5:58475287-58475309 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
990883725 5:60568756-60568778 CCCTAGGAGGGACTCTGTGTGGG + Intergenic
991009938 5:61872028-61872050 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
991104899 5:62832789-62832811 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
991183868 5:63785460-63785482 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
991206907 5:64060015-64060037 ATCCAATAGGGACTCTGTGTGGG - Intergenic
991535951 5:67669456-67669478 CTCCAGTAAGGACTCTGTGTGGG - Intergenic
992854839 5:80849374-80849396 CCCCAGTAGGGACTCTGTGTGGG + Intronic
992969596 5:82043001-82043023 CTCCAGTGGGGACTCTGTGTAGG + Intronic
993215851 5:85021747-85021769 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
993229996 5:85222829-85222851 AATCAGGAGGGAAAATGTGTTGG + Intergenic
993309720 5:86314040-86314062 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
993690745 5:90996590-90996612 TCCCAGTAGGGACTCTGTGTCGG - Intronic
993945943 5:94116874-94116896 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
994325659 5:98442297-98442319 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
994338805 5:98601096-98601118 CTCCAGTGGGGACTCTGTGTTGG - Intergenic
994494118 5:100488538-100488560 CTCCAGTAGGTACTCTGTGTGGG + Intergenic
994548758 5:101205168-101205190 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
994552814 5:101258885-101258907 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
994649097 5:102504483-102504505 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
994655936 5:102593241-102593263 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
994831260 5:104786290-104786312 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
994920060 5:106031926-106031948 CCCCAGTAAGGACACTGTGTGGG + Intergenic
994936079 5:106255352-106255374 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
995113541 5:108454102-108454124 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
995129313 5:108612995-108613017 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
995147803 5:108806381-108806403 CCCCAGTAGGGACTCTGTGTGGG - Intronic
995281543 5:110341211-110341233 AGCCAGGAGGGTCACTGCATAGG - Intronic
995312658 5:110731369-110731391 CCCCAGTAGGGACTCTGTGTGGG + Intronic
995389769 5:111627300-111627322 TCCCAGTGGGGACACTGTGTTGG - Intergenic
996177610 5:120378763-120378785 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
996196369 5:120611785-120611807 CCCCAGTAGGGACTCTGTGTGGG - Intronic
996214299 5:120848660-120848682 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
996247569 5:121283112-121283134 ACCCAGTAGGGACTCCGTGTAGG - Intergenic
996311021 5:122105339-122105361 ATAAAGCAGGGACACTGTGACGG - Intergenic
996320746 5:122212334-122212356 ATCCTGCAAGGACACTGAGTAGG + Intergenic
996460213 5:123732799-123732821 CCCCAGTAGGGACACTGTGTGGG - Intergenic
996526836 5:124489072-124489094 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
996617427 5:125458139-125458161 CCCCAGAAGGGACTCTGTGTTGG - Intergenic
996774718 5:127121045-127121067 ATCCAGTGGGGACTCTGTGTGGG + Intergenic
997491989 5:134285205-134285227 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
998889382 5:146729909-146729931 CCCCAGTAGGGACTCTGTGTGGG - Intronic
999012320 5:148056330-148056352 GCCCAGTAGGGACTCTGTGTGGG - Intronic
999020814 5:148163688-148163710 ATCCAGTGGAGACCCTGTGTAGG + Intergenic
999669345 5:153945039-153945061 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1000496314 5:161989533-161989555 CCCCAGTAGGGACTCTGTGTTGG + Intergenic
1000676931 5:164132631-164132653 ACCCAGTGGGGACCCTGTGTGGG - Intergenic
1000741495 5:164974952-164974974 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1000777843 5:165442038-165442060 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1001352300 5:170980792-170980814 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1001361546 5:171091000-171091022 TTCCAGAAGGGACTCTGTGAGGG - Intronic
1001684895 5:173585993-173586015 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1001783057 5:174387077-174387099 CTCCAGCAGGGACACTGACTGGG + Intergenic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1003401725 6:5796221-5796243 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1003659334 6:8045430-8045452 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1004402907 6:15305254-15305276 ATAAAGGAGGGACAGTGTGCAGG - Intronic
1005655238 6:27928984-27929006 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1005875084 6:30005256-30005278 ATTCAGGAGTGACAGTGTGATGG + Intergenic
1005921750 6:30407757-30407779 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1006229389 6:32570126-32570148 ATCCAGGATGGAAACTGGATTGG - Intronic
1006476828 6:34260985-34261007 CCCCAGGAAGGACTCTGTGTGGG + Intergenic
1006697171 6:35940914-35940936 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1006826286 6:36938658-36938680 CTCCCAGAGGCACACTGTGTGGG - Intergenic
1007448180 6:41923067-41923089 ATCCAGGTGAGAGACTGTGGTGG - Intronic
1007856591 6:44864398-44864420 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1008650121 6:53553062-53553084 CTCCATTAGGGACTCTGTGTGGG - Intronic
1008820941 6:55629986-55630008 CCCCAATAGGGACACTGTGTGGG - Intergenic
1009051612 6:58283036-58283058 CTCCAGTGGGGACTCTGTGTTGG - Intergenic
1009396653 6:63207065-63207087 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1009481018 6:64157870-64157892 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1009490486 6:64284562-64284584 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1009538641 6:64924009-64924031 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1009631685 6:66208693-66208715 CTCCAGTAGGGACTCTGTATAGG + Intergenic
1009726091 6:67537471-67537493 CTCCACTAGGGACATTGTGTGGG - Intergenic
1009825090 6:68857206-68857228 CTACAGTAGGGACTCTGTGTGGG - Intronic
1009980428 6:70720502-70720524 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1010175628 6:73024888-73024910 ATTGAGGAGAGACACTGTGCTGG - Intronic
1010248320 6:73682627-73682649 ACCCAGTAGGGAATCTGTGTGGG + Intergenic
1010555593 6:77275189-77275211 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1010909517 6:81536432-81536454 CTCCAGTGGGGACTCTGTGTGGG + Intronic
1011088649 6:83570893-83570915 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1011152497 6:84289921-84289943 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1011169436 6:84489508-84489530 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
1011170970 6:84504039-84504061 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1011348721 6:86399670-86399692 CTCCAGAGGGGACTCTGTGTGGG + Intergenic
1011378619 6:86718759-86718781 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1011919025 6:92547813-92547835 CCCCAGTAGGGACTCTGTGTCGG - Intergenic
1011942263 6:92857303-92857325 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1012141519 6:95631800-95631822 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
1012224173 6:96686136-96686158 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1012683240 6:102209753-102209775 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1012690739 6:102308039-102308061 TCCCAGTAGGGACCCTGTGTGGG + Intergenic
1012723882 6:102783931-102783953 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1012780058 6:103546611-103546633 CCCCAGGGGGGACTCTGTGTGGG + Intergenic
1012826339 6:104151489-104151511 GCCCAGTAGGGACTCTGTGTTGG + Intergenic
1013077043 6:106780893-106780915 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1013127445 6:107198228-107198250 ACCCAGTAGGGACACATTGTTGG + Intronic
1013558737 6:111283521-111283543 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1013910725 6:115272807-115272829 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1014143585 6:117971486-117971508 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1014475928 6:121872221-121872243 CTCCAGTGGGGACTCTGTGTAGG + Intergenic
1014665374 6:124230875-124230897 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1014730933 6:125030843-125030865 CCCCAATAGGGACACTGTGTAGG + Intronic
1014771818 6:125465833-125465855 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1014863211 6:126496474-126496496 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1015351581 6:132225751-132225773 TCCCAGTAGGGACTCTGTGTCGG - Intergenic
1015523210 6:134151808-134151830 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1015667734 6:135650613-135650635 CCCCAGGAGGAACTCTGTGTGGG - Intergenic
1016139796 6:140594519-140594541 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1016253238 6:142072079-142072101 CTCCAGTAGGGATTCTGTGTGGG - Intronic
1016261312 6:142174062-142174084 ATCCAGGTGGGACTGTGTGTGGG - Intronic
1016281753 6:142426634-142426656 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1016284939 6:142462614-142462636 CCCCAAAAGGGACACTGTGTGGG + Intergenic
1016411140 6:143785564-143785586 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1016419983 6:143873452-143873474 CTCCACCAGGGACTCTGTGTGGG + Intronic
1016424192 6:143916418-143916440 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1016649572 6:146448389-146448411 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1017388009 6:153908183-153908205 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1017525361 6:155237472-155237494 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1017536607 6:155353385-155353407 ATCCTGAAGGGACCCTGTCTTGG + Intergenic
1017547514 6:155468146-155468168 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1017833399 6:158153049-158153071 ATCCGGGAGGGACACATTGTGGG - Intronic
1018407718 6:163505287-163505309 ACCCAGTGGGGACTCTGTGTGGG - Intronic
1018573764 6:165236842-165236864 CCCCAGTAGGGGCACTGTGTGGG - Intergenic
1018795171 6:167179850-167179872 ACCCAGGAGGAAGACAGTGTCGG - Intronic
1018821148 6:167375212-167375234 ACCCAGGAGGAAGACAGTGTCGG + Intronic
1019150400 6:170001660-170001682 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1020345099 7:7154075-7154097 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1020470142 7:8525921-8525943 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1021036816 7:15809819-15809841 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1021628916 7:22624256-22624278 ATCCAGGAGGCACACTGATTGGG + Intronic
1021646673 7:22795929-22795951 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1021787178 7:24163994-24164016 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1022549739 7:31227516-31227538 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1022595958 7:31713551-31713573 CACCAGTAGGGACACTGTGTTGG + Intergenic
1022678419 7:32522146-32522168 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1022862543 7:34383044-34383066 CCCCAGTGGGGACACTGTGTGGG - Intergenic
1023145649 7:37148055-37148077 ATACAGCAGAGACACTGTCTAGG + Intronic
1023236884 7:38099307-38099329 CCCCAGTAGGGACTCTGTGTTGG - Intergenic
1023786917 7:43717123-43717145 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1024063417 7:45715185-45715207 GTCCAGGAGGGCCACTGGGAAGG + Exonic
1024137904 7:46429613-46429635 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1024812067 7:53223615-53223637 CTGCAGGAGGGACACTGTGGGGG - Intergenic
1024814877 7:53256987-53257009 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1025285803 7:57659768-57659790 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1025300348 7:57814996-57815018 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1026532601 7:71212466-71212488 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1027300382 7:76827800-76827822 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1027556508 7:79670515-79670537 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1027586658 7:80066477-80066499 ATCCACTGGGGACTCTGTGTGGG + Intergenic
1027604549 7:80284247-80284269 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1027626034 7:80545760-80545782 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1028126130 7:87115206-87115228 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1028189193 7:87825540-87825562 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1028286733 7:89011899-89011921 CTCCAGTGGGGACACTGTGGGGG + Intronic
1028624499 7:92862943-92862965 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1028668328 7:93372279-93372301 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1028790193 7:94844713-94844735 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1028981520 7:96972388-96972410 ATCCATGAGGGACATGGTTTGGG - Intergenic
1029174587 7:98655684-98655706 ATTCAGGAGGGAAACAGTGGGGG + Intergenic
1029939436 7:104464416-104464438 CTCCAGTGGGGACTCTGTGTGGG + Intronic
1030144657 7:106341148-106341170 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1030357296 7:108556793-108556815 TCCCAGTAGGGACTCTGTGTGGG + Intronic
1030826842 7:114169131-114169153 CACCAGTAGGGACTCTGTGTGGG - Intronic
1030868781 7:114731646-114731668 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1030970076 7:116045677-116045699 CCCCAGGAGGGACTCTGTGTGGG - Intronic
1031299217 7:120042832-120042854 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1031301639 7:120068251-120068273 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1031779031 7:125939507-125939529 ACCCAGTGGGGACTCTGTGTGGG - Intergenic
1031792009 7:126118289-126118311 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1031807922 7:126329477-126329499 ACCCAGTATGGACTCTGTGTCGG - Intergenic
1032053193 7:128662618-128662640 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1032330531 7:130975065-130975087 CTCCAGTGGGGACACTGTGTAGG - Intergenic
1033031572 7:137832232-137832254 CCCCAGGAGGGACTCTGAGTGGG + Intronic
1034101625 7:148456212-148456234 ATGCAGGAGAGTGACTGTGTCGG + Intergenic
1034751023 7:153569186-153569208 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1034751341 7:153571690-153571712 ATCCAGCAGGGACCCTGTATGGG - Intergenic
1035317539 7:158006198-158006220 TTCCACGAGGAACACAGTGTTGG - Intronic
1036452964 8:8884560-8884582 ATGCTGGAGGAACACTGTGAGGG + Intronic
1036478100 8:9112301-9112323 CTGCAGCATGGACACTGTGTTGG + Intronic
1036766078 8:11550081-11550103 GTGCAGGAGGGAGGCTGTGTGGG + Intronic
1038139059 8:24822716-24822738 CCCCAGTAGGGACCCTGTGTGGG - Intergenic
1038298995 8:26324611-26324633 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1039642716 8:39241377-39241399 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1040925865 8:52681943-52681965 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1041479759 8:58307091-58307113 CTCCAGTAGGGATTCTGTGTGGG + Intergenic
1041703262 8:60815718-60815740 ATCCTGGAGGAACACAGTCTGGG + Intronic
1041793071 8:61717058-61717080 ACCCAGTATGGACTCTGTGTGGG + Intergenic
1041867988 8:62598707-62598729 ACGTAGAAGGGACACTGTGTTGG + Intronic
1042057961 8:64786719-64786741 CCCCAGGAGTGACTCTGTGTGGG + Intronic
1042073903 8:64967494-64967516 ACCCAGTAGGGACTCTGTGTGGG + Intergenic
1042169796 8:65980323-65980345 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1042432777 8:68727506-68727528 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1042601342 8:70502570-70502592 CTCCAGTGGGGACTCTGTGTCGG - Intergenic
1043085570 8:75827397-75827419 CCCCAGGGGGGACTCTGTGTGGG - Intergenic
1043092983 8:75928313-75928335 ATCCAGTAGGTACTCTCTGTGGG + Intergenic
1043694783 8:83204716-83204738 CTCCAGTAGGGACTCTGTCTGGG - Intergenic
1043834682 8:85033086-85033108 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1044010135 8:86984379-86984401 CCCCAGTAGGGACTCTGTGTTGG - Intronic
1044017139 8:87058401-87058423 TTCCAGTTGGGACTCTGTGTGGG + Intronic
1044087170 8:87955688-87955710 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1044443046 8:92243297-92243319 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1045139860 8:99268250-99268272 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1045214141 8:100130057-100130079 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1045258091 8:100546625-100546647 CTCCAGTGGGGACTCTGTGTGGG - Intronic
1045732233 8:105255807-105255829 CCCCAGTAGGGACTCTGTGTTGG + Intronic
1046129301 8:109946875-109946897 CTCCAGTACGGACTCTGTGTGGG - Intergenic
1046207167 8:111015549-111015571 CTCAAGTAGGGACTCTGTGTGGG - Intergenic
1046231498 8:111364383-111364405 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1046232332 8:111373837-111373859 ACCCAGTGGGGACTCTGTGTGGG - Intergenic
1046243740 8:111532009-111532031 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1046305322 8:112357877-112357899 CCCCAGTAGGGACTCTGTGTAGG - Intronic
1046400916 8:113702635-113702657 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1046492229 8:114967932-114967954 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1046814796 8:118571869-118571891 CTCCAGTAGGGACTCTGTGCTGG - Intronic
1046878026 8:119277648-119277670 ATCCAGTGGAGACTCTGTGTGGG + Intergenic
1047224402 8:122944138-122944160 ATCCAGGAGAGACTGTGTGGTGG + Intronic
1047535102 8:125712417-125712439 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1048046126 8:130775021-130775043 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1048064948 8:130957992-130958014 CCCCAGTAGGGACTCTGTGTTGG - Intronic
1048207272 8:132425122-132425144 ATCCACGAGCTCCACTGTGTGGG - Intronic
1048478889 8:134769655-134769677 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1048660920 8:136600148-136600170 CTTCAGTAGGGACTCTGTGTGGG - Intergenic
1048772749 8:137912832-137912854 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1048781548 8:138007363-138007385 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1048782996 8:138022037-138022059 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1048832006 8:138486617-138486639 CTCAAGGAGGAAGACTGTGTGGG + Intronic
1049076331 8:140399250-140399272 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1049275327 8:141717425-141717447 AGGCAGGAGGGAAACTGTGAAGG - Intergenic
1049582557 8:143419393-143419415 ATCCAAGAGGGACAGTGTGGGGG - Intronic
1049956114 9:694780-694802 ACCCAGGAGGGACACTGCACTGG + Intronic
1050079826 9:1904480-1904502 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1050156028 9:2667118-2667140 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1050255647 9:3789550-3789572 CCCCAGTAGGGACTCTGTGTCGG - Intergenic
1050905135 9:10994021-10994043 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1050935771 9:11392935-11392957 CCCCAGTGGGGACACTGTGTAGG - Intergenic
1051309827 9:15758042-15758064 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1051771372 9:20583437-20583459 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1051946249 9:22573144-22573166 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1051957467 9:22713392-22713414 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1051975403 9:22942136-22942158 CCCCAGTAGGGACACTGTGTGGG + Intergenic
1052087939 9:24290983-24291005 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1052093426 9:24357009-24357031 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1052220616 9:26017490-26017512 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1052351736 9:27465557-27465579 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1052626033 9:30978540-30978562 CTCAAGTAGGGACTCTGTGTGGG - Intergenic
1052701358 9:31941579-31941601 CCCCAGCAGGGACTCTGTGTCGG - Intergenic
1052956476 9:34256433-34256455 CTCCAGGAGGGACATGGTGAGGG + Exonic
1053246058 9:36535585-36535607 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1053641640 9:40088094-40088116 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1053764495 9:41377370-41377392 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1054322528 9:63685483-63685505 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1054543111 9:66288547-66288569 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1055080786 9:72266044-72266066 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1055312597 9:74998649-74998671 AACCAGGAGGAAGACTGTGGGGG + Exonic
1055595637 9:77862247-77862269 CCCCAGGAGGGACTCTGTGTGGG + Intronic
1055628323 9:78196870-78196892 ATCCTGGAGGCACAGTGTTTGGG + Intergenic
1055878500 9:80970904-80970926 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1056008183 9:82296429-82296451 AATTAGGAGGGACACTGTGGAGG + Intergenic
1056021297 9:82440964-82440986 CACCAGCTGGGACACTGTGTGGG - Intergenic
1056148967 9:83765420-83765442 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1056595185 9:88002140-88002162 CCCCAGTAGGGACTCTGTGTAGG - Intergenic
1056702004 9:88918674-88918696 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1056924362 9:90820288-90820310 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1057316443 9:93971856-93971878 CACCAGTAGGGACTCTGTGTGGG + Intergenic
1057930152 9:99185963-99185985 ATCCAGTTGGGACACTTTGGGGG - Intergenic
1058141179 9:101358094-101358116 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1058149946 9:101452868-101452890 GTCCAGTAGGGACTCTGTATGGG - Intergenic
1058181755 9:101807929-101807951 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1058380470 9:104371953-104371975 TTTCAGCAGGGACTCTGTGTGGG - Intergenic
1058401575 9:104625425-104625447 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1059482275 9:114600742-114600764 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1059562406 9:115347976-115347998 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1059986317 9:119823814-119823836 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1060018444 9:120107613-120107635 ATCAAAGAGGGAGTCTGTGTGGG - Intergenic
1060178331 9:121514163-121514185 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1060311974 9:122470533-122470555 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1060348768 9:122839175-122839197 ACCCAGTGGGGACTCTGTGTGGG + Intergenic
1061163547 9:128909789-128909811 ACCCAGGACAGAAACTGTGTGGG + Intronic
1061497864 9:130985912-130985934 AGCCAGGTGGGACACTTTGAAGG + Intergenic
1061516528 9:131093406-131093428 ATCCAGGAGGGGGATGGTGTGGG + Intronic
1062369057 9:136227534-136227556 ATCCAAGAGGTAGAATGTGTGGG - Intronic
1062616855 9:137401113-137401135 TCCCAGTAGGGACTCTGTGTGGG + Intronic
1202789416 9_KI270719v1_random:71180-71202 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1185685715 X:1926640-1926662 AACAAGGAGTGACACTGTGAAGG - Intergenic
1185893663 X:3840926-3840948 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1185898778 X:3879350-3879372 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1185903895 X:3917779-3917801 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1186053343 X:5623820-5623842 TTCCAGTGGGGACTCTGTGTGGG - Intergenic
1186084901 X:5976878-5976900 ATTCAGAAGTGACACTGAGTTGG - Intronic
1186165272 X:6820895-6820917 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1186222750 X:7366796-7366818 TTTCAGTAGGGACTCTGTGTGGG - Intergenic
1186797624 X:13062173-13062195 CCCCAGGAGGGACTCTGTGTGGG + Intergenic
1186992471 X:15084698-15084720 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1187070089 X:15879446-15879468 TTCCAGTGGGGACTCTGTGTGGG + Intergenic
1187072330 X:15900888-15900910 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1187555215 X:20344786-20344808 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1187667368 X:21628395-21628417 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1187808958 X:23154310-23154332 AACAAACAGGGACACTGTGTTGG + Intergenic
1188106765 X:26156175-26156197 GCCCAGTAGGGACTCTGTGTGGG + Intergenic
1188305688 X:28557993-28558015 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1188449604 X:30295187-30295209 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1188749277 X:33885340-33885362 CTCCAGTGGGGACTCTGTGTGGG - Intergenic
1188753794 X:33935968-33935990 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1188804469 X:34570312-34570334 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1188997633 X:36905073-36905095 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1189028804 X:37428742-37428764 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1189087976 X:38047181-38047203 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1189228765 X:39435594-39435616 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1189253713 X:39621138-39621160 CCCCAGAAGGGACTCTGTGTGGG + Intergenic
1189371310 X:40431702-40431724 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1190008367 X:46760503-46760525 AACCTGGATGGGCACTGTGTTGG + Intergenic
1190269641 X:48852741-48852763 CTCCAGTGGGGACTCTGTGTGGG + Intergenic
1190513258 X:51195537-51195559 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1190514334 X:51207188-51207210 GCCCAGTAGGGACTCTGTGTGGG - Intergenic
1191052269 X:56206784-56206806 CTCCAGATGGGACTCTGTGTGGG + Intergenic
1191116399 X:56857617-56857639 CACCAGTAGGGACTCTGTGTTGG + Intergenic
1191171032 X:57447415-57447437 CTCCAGTGGGGACTCTGTGTGGG + Intronic
1191856096 X:65628185-65628207 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1192162492 X:68798915-68798937 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1192705414 X:73524567-73524589 ATCCTGGAAGGACACGGTGATGG - Intergenic
1192846314 X:74910072-74910094 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1193221205 X:78928938-78928960 ACCCAGTAGGGACTCTGTGTGGG + Intergenic
1193271856 X:79537861-79537883 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1193406458 X:81107569-81107591 TCCCAGTGGGGACACTGTGTGGG - Intergenic
1193519565 X:82512214-82512236 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1193662478 X:84274190-84274212 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1193707855 X:84844759-84844781 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1193711361 X:84884167-84884189 CTCCAGTAGGGACTCTGTATGGG - Intergenic
1193808038 X:86016744-86016766 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1194042763 X:88962463-88962485 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1194409815 X:93543812-93543834 CTCCAGTGGAGACACTGTGTGGG + Intergenic
1194473994 X:94335778-94335800 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1194501779 X:94690533-94690555 CCCCAATAGGGACACTGTGTGGG - Intergenic
1194503790 X:94708430-94708452 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1194566447 X:95494557-95494579 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1194756333 X:97743507-97743529 TCCCAGTAGGGACTCTGTGTGGG - Intergenic
1194838700 X:98713503-98713525 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1194874921 X:99174967-99174989 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1195522737 X:105849976-105849998 CCCCAGTAGGGACTCTGTGTGGG + Intronic
1195554834 X:106210297-106210319 CCCCAGTAGGGACTCTGTGTTGG + Intergenic
1195590730 X:106622390-106622412 TTCTAGGTGGGACAATGTGTTGG + Intronic
1195823576 X:108972907-108972929 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1196246318 X:113404165-113404187 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1196368267 X:114947025-114947047 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1197075023 X:122343427-122343449 TCCCAGTAGGGACTCTGTGTGGG + Intergenic
1197092584 X:122556375-122556397 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1197160535 X:123317833-123317855 CCCCAGTAGGGACTCTGTGTAGG + Intronic
1197583190 X:128310772-128310794 ACCCAGTGGGGACTCTGTGTGGG + Intergenic
1197911006 X:131482579-131482601 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1197914599 X:131521211-131521233 CTCCAGTAGGGACTCTTTGTGGG - Intergenic
1197975697 X:132163583-132163605 CCCCAGGAGGGACTCTGTGTGGG - Intergenic
1198569803 X:137942545-137942567 GTCCAGTAGGGACTCTGTGCGGG - Intergenic
1198619451 X:138490203-138490225 ATGGAGGAGGGCCACTGTGGAGG - Intergenic
1198919334 X:141708189-141708211 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1199020348 X:142870748-142870770 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1199060536 X:143350776-143350798 CCCCAGTAGGGACTCTGTGTGGG + Intergenic
1199155000 X:144536714-144536736 CCCCAGTAGGGACTCTGTGTAGG + Intergenic
1200296486 X:154925350-154925372 CCCCAGTAGGGACTCTGTGTGGG - Intronic
1200872724 Y:8121082-8121104 TTCCAGGAGGAACACAGGGTAGG + Intergenic
1200944899 Y:8824976-8824998 TTCCAGTAGGGACTCTGTGTTGG + Intergenic
1201259816 Y:12148013-12148035 ATCCTGGTGGGACTCTGGGTGGG + Intergenic
1201452282 Y:14129338-14129360 GCCCAGTAGGGACTCTGTGTAGG - Intergenic
1201469500 Y:14318004-14318026 CCCCAGTAGGGACTCTGTGTGGG - Intergenic
1201692835 Y:16788716-16788738 ACCCAGGAAGCACAATGTGTCGG + Intergenic
1202101249 Y:21310173-21310195 TTCCAGGAGGAACACAGGGTAGG + Intergenic