ID: 1180598245

View in Genome Browser
Species Human (GRCh38)
Location 22:16993952-16993974
Sequence GGGTGTTCACAAATGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180598245_1180598249 26 Left 1180598245 22:16993952-16993974 CCTTCTTGCATTTGTGAACACCC 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1180598249 22:16994001-16994023 AACAGTTCTCCACCTCTACTAGG 0: 1
1: 0
2: 0
3: 4
4: 128
1180598245_1180598246 -7 Left 1180598245 22:16993952-16993974 CCTTCTTGCATTTGTGAACACCC 0: 1
1: 0
2: 0
3: 17
4: 161
Right 1180598246 22:16993968-16993990 AACACCCTCTCGCTCACAAACGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180598245 Original CRISPR GGGTGTTCACAAATGCAAGA AGG (reversed) Intronic
901402552 1:9024842-9024864 GGCTGCTCCCAAAGGCAAGATGG + Intronic
905746655 1:40423954-40423976 GGGTGTACTCAAAGGAAAGAAGG - Intergenic
905925702 1:41748132-41748154 GACTGGTCACAAATGCAAGGTGG + Intronic
907363659 1:53943043-53943065 TGGTGCTCACAAATGGAAAAAGG + Intronic
910133703 1:83940857-83940879 GGTTTTACACAAATGAAAGAAGG - Intronic
915027189 1:152842079-152842101 GGGTGTTCACAAATGCCTTAGGG + Intergenic
916492883 1:165317049-165317071 GGGGGTTCAGAAATGTATGAAGG - Intronic
918427421 1:184424972-184424994 AGATGTTCATAAATGCAGGATGG - Intronic
919523527 1:198619319-198619341 TGGAGTTCACAAATGGCAGAAGG - Intergenic
919926287 1:202193521-202193543 GGCTGTCCCCAAAGGCAAGAGGG + Intergenic
920337670 1:205256120-205256142 GGGTAGTCCCAAATTCAAGAAGG - Intronic
921159556 1:212463506-212463528 GGGTGTTCCTAAGGGCAAGAAGG - Intergenic
922117509 1:222628627-222628649 GGGAGTTCAGGAATCCAAGAGGG + Exonic
923195694 1:231664529-231664551 GGGTGCTCATAAAGGAAAGAGGG + Intronic
1066108522 10:32176681-32176703 AGGTGTTAAAAAATGGAAGAGGG + Intergenic
1066135799 10:32445155-32445177 GTGTGTTCAAAAATTCATGAAGG - Intergenic
1067157547 10:43794718-43794740 GGGTCTTCATAAATTCCAGAAGG - Intergenic
1068819221 10:61353541-61353563 GGGTGTTTACAAAAGCAATGAGG - Intergenic
1069358008 10:67609956-67609978 GGGTTTTCACAAATTCCAAAAGG + Intronic
1072548974 10:96462792-96462814 CGGTGTTCCTAATTGCAAGACGG - Intronic
1075240378 10:120773217-120773239 GGGTGTTCCCTAAAGTAAGAGGG + Intergenic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1076857547 10:133124707-133124729 GGGTGTTCCCAGCTGCCAGACGG + Intronic
1080698488 11:34623832-34623854 GGGCTTTCAGAAAAGCAAGATGG - Intronic
1085764197 11:79268846-79268868 TGGTGTTCCTAAGTGCAAGAAGG + Intronic
1086983072 11:93219618-93219640 GTGTGTTCATACATGCAAGAGGG + Intergenic
1087924222 11:103900764-103900786 TGGTGTTCCTAAATGCAATAAGG + Intergenic
1088079942 11:105899894-105899916 TAGTGTTCGCAAGTGCAAGAAGG - Intronic
1089117721 11:116109576-116109598 GGGTGTGCACAAATGGCAGAAGG + Intergenic
1090346641 11:126076912-126076934 CTGTGCTCACAAATGCCAGAGGG + Intergenic
1091941299 12:4485392-4485414 TGGTGTTCCCAAGTGCAAGAAGG - Intergenic
1092059211 12:5534884-5534906 GTGTGTTCTCATCTGCAAGATGG - Intronic
1092478901 12:8842518-8842540 GGGTGTTAACATATGCAACAGGG - Intronic
1092894281 12:12998047-12998069 GGCTGGACACAAATGCAATAAGG - Intronic
1093223129 12:16447456-16447478 GTGTTTTCTCATATGCAAGAAGG + Intronic
1098671471 12:73235562-73235584 GGGTGCTGACAAGTGCAGGAGGG - Intergenic
1099690071 12:85940733-85940755 GAGAGTTCAGAAATTCAAGAAGG - Intergenic
1101216174 12:102586402-102586424 GGGTGTTCAAAAATTCCAGCTGG - Intergenic
1103212609 12:119178053-119178075 GGGTGATCAGAAATCGAAGATGG - Intergenic
1104404182 12:128503958-128503980 GTCTGTTCACAACTGCAAAAGGG - Intronic
1108425339 13:50293461-50293483 GGGTGTTCTCCAATCCAAGGTGG - Intronic
1111430200 13:88139281-88139303 TAATGTACACAAATGCAAGAAGG + Intergenic
1113097463 13:106680789-106680811 GGGTGTTAAAAAAGGCAAGTAGG + Intergenic
1113191375 13:107750941-107750963 TGGTGTACACAAATGAAAGTTGG + Intronic
1114582429 14:23774586-23774608 AGGTGTGCACAAAGGCAGGAAGG + Intergenic
1116644856 14:47514318-47514340 AGGAGCTCACAAATGAAAGATGG - Intronic
1117108214 14:52420723-52420745 TGGTATTCACAATTCCAAGAAGG + Intergenic
1119181730 14:72609956-72609978 GGGTGTTCAAAAGAGCAAAAAGG + Intergenic
1120048087 14:79831372-79831394 GGCATTTCACACATGCAAGATGG + Intronic
1120580939 14:86247720-86247742 GGGTTTTGACAAATGCCTGATGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121921439 14:97885579-97885601 GGGTGTGGACAAATGGAAAATGG - Intergenic
1126707128 15:51415989-51416011 GGGGGTTCACAAAAGCCACAGGG - Intergenic
1127037514 15:54934265-54934287 ATGAGTTCACAAATGCAAAATGG + Intergenic
1135906016 16:26512470-26512492 GTGTGTTCACAATTGCATGCTGG + Intergenic
1135941731 16:26827825-26827847 GAGTGTGAACAATTGCAAGAAGG + Intergenic
1138737865 16:59272796-59272818 TGGTGTTCCTAAATACAAGAAGG + Intergenic
1138985711 16:62325974-62325996 GGTTATTAACAAATGAAAGAAGG + Intergenic
1141568325 16:84918451-84918473 GGGTGTTCAGAGATGCATCATGG + Intronic
1141838352 16:86557917-86557939 GGGTTTTGACAAATGCATAATGG + Intergenic
1142652807 17:1367270-1367292 TGATGTTCACATATGTAAGATGG + Intronic
1146269550 17:31475852-31475874 TAGTGTTCCTAAATGCAAGAAGG + Intronic
1148221727 17:45867442-45867464 GGTTGTTTACAAATTCAGGAGGG - Intergenic
1150113140 17:62519932-62519954 GGGTGTTCCCAAAAACAATAGGG - Intronic
1153809966 18:8743709-8743731 GGGTTTTTAAAAATGAAAGAGGG - Intronic
1153852064 18:9104231-9104253 GTGTGTTCCCAAATGAAATAAGG + Intronic
1153864900 18:9257204-9257226 GTATGTTCACAAATGACAGAAGG - Exonic
1157036015 18:43975191-43975213 TGGTGTTAACAAATGCTAGAGGG - Intergenic
1158111384 18:53944127-53944149 GGGTGTCCACAAAGTAAAGAAGG - Intergenic
1159137011 18:64348314-64348336 GGGTGAACATAAATGGAAGATGG + Intergenic
1163213641 19:15860187-15860209 TAGTGTTCCTAAATGCAAGAAGG + Intergenic
1163832712 19:19554657-19554679 GGGTGTCCCCAAAGGCAAGAAGG + Intergenic
936441911 2:112561762-112561784 TAGTGTTCATAAATGCAAAAAGG - Intronic
936647245 2:114386188-114386210 GTGTGTGCACAAGTGCATGAGGG + Intergenic
937331830 2:121035804-121035826 TGGTGTTCCTAAGTGCAAGAAGG - Intergenic
938653217 2:133405356-133405378 TGGTGTTCATAAGTGCACGAAGG - Intronic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
943635643 2:190303847-190303869 GGGTTTTGACAAATGCATCAGGG - Intronic
944443418 2:199765179-199765201 GGGTTTTGACAAATGCATAATGG - Intronic
945804915 2:214478741-214478763 GGGTGTTCCTCAAGGCAAGAGGG - Intronic
1169152975 20:3305082-3305104 TGTAGTTCACAAAAGCAAGATGG + Intronic
1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG + Intronic
1169815393 20:9650951-9650973 AGGTGTTCAAAAAAGCAAGATGG + Intronic
1174394209 20:50236390-50236412 GGGTGAAGACAAATGTAAGAGGG - Intergenic
1175534774 20:59701783-59701805 GGGTTTTGACAAATGCATAATGG + Intronic
1176688609 21:9878024-9878046 GGGTGTTCTCACATGTGAGATGG + Intergenic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
1181482330 22:23208191-23208213 AGGTTCTCACAAATGCCAGAGGG - Intronic
1181906631 22:26202407-26202429 GGGTCTTCATAAATTCATGATGG + Intronic
1184322242 22:43751379-43751401 GGGAGTTGACAAATGATAGATGG + Intronic
1184346834 22:43918692-43918714 GTTTGTTCACAAATGCGAGAAGG + Intergenic
1184367404 22:44061077-44061099 TAGTGTTCCCAAGTGCAAGAAGG - Intronic
1184919790 22:47597765-47597787 GGGTTTTGACAAATGCATAATGG + Intergenic
952754643 3:36855729-36855751 AGGTGTTCAAAAATGAAATATGG - Exonic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
956058695 3:65327979-65328001 GGGTTTTCTCATATGCAAAATGG + Intergenic
957343985 3:78938879-78938901 GGGTGTTCAACAATGCGAGGTGG + Exonic
958119995 3:89273860-89273882 CAGTGTTCCTAAATGCAAGAAGG - Intronic
963947403 3:151161373-151161395 GGCTGTTCAAAAACCCAAGAGGG + Intronic
964294398 3:155217377-155217399 GGCTGTTCCTAAATGCAAGGTGG - Intergenic
965472930 3:169117518-169117540 GGGTTTTCATAAATGCAGGAAGG - Intronic
966856960 3:184201023-184201045 GGGTGTGCTCAAAGGCATGAGGG - Intronic
971604235 4:28636889-28636911 GAGTGTTCAGAAAGGCAAAATGG + Intergenic
973711018 4:53630561-53630583 TGGTGTTCCTAAGTGCAAGAAGG + Intronic
973793190 4:54396880-54396902 GGGTGTACACAAGGGGAAGAAGG + Intergenic
974286547 4:59876430-59876452 GGATGTTCACAATTTCAGGATGG + Intergenic
976690992 4:87866891-87866913 GGGTGTTCAAAGATGCACAAAGG + Intergenic
976938519 4:90670363-90670385 GGGAATTCACTAAAGCAAGAAGG + Intronic
977963688 4:103117363-103117385 GGGTTTTGACAAATGTAAAATGG + Intronic
980351998 4:131695825-131695847 GGGTGTTCTCACATGTGAGATGG + Intergenic
983289644 4:165785720-165785742 GGATGTCCAGAAATGGAAGATGG + Intergenic
983900601 4:173129238-173129260 GTGTGTTCACGGATGGAAGATGG + Intergenic
984312588 4:178081942-178081964 TGGTGTTCCTAAATACAAGAAGG - Intergenic
984567001 4:181343099-181343121 TGGTGCTCACAACTGCACGAAGG + Intergenic
988188292 5:27896928-27896950 GGGTGGTTACAAATGGAAGAGGG + Intergenic
992426568 5:76663603-76663625 GTGTGTTCACTAATAAAAGATGG + Intronic
992524063 5:77588913-77588935 TGGTGTTCCTAAGTGCAAGAAGG - Intronic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
993251605 5:85531834-85531856 GGCTGGTGAAAAATGCAAGATGG - Intergenic
993612044 5:90066237-90066259 GGGTCTTTAAAAATGGAAGAGGG - Intergenic
994816693 5:104594824-104594846 GGATGTGCCCAAAGGCAAGAGGG - Intergenic
999738887 5:154534268-154534290 TGGTGTTTACACAGGCAAGAGGG + Intergenic
1000541333 5:162543729-162543751 GAGTGTTGACAATAGCAAGATGG + Intergenic
1001795976 5:174502671-174502693 GGGTGTTCACCATTACAAGATGG + Intergenic
1001834918 5:174823885-174823907 GGGTCTACACTAATGGAAGAAGG + Intergenic
1003410884 6:5862075-5862097 GGGTCCTCACAAGTGGAAGAAGG + Intergenic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1006252051 6:32795925-32795947 GGGTGTTCACAAATAAAAAATGG + Intergenic
1007352668 6:41285235-41285257 GTCTGTGCACAATTGCAAGAAGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1011808014 6:91095316-91095338 GGGCCTTCAGAACTGCAAGAGGG - Intergenic
1012481053 6:99667341-99667363 GGGTGTTAAGAAATGCAAAGGGG + Intergenic
1012567194 6:100672593-100672615 GTGTGTTCACAAATGTTGGAAGG + Intronic
1015241494 6:131028929-131028951 GGCTATTCAAAAATGCAACAAGG - Intronic
1018737216 6:166696287-166696309 GGGTGATCAGAAATGAGAGATGG + Intronic
1024916504 7:54505964-54505986 TGGTGTTCACAAGAACAAGAAGG - Intergenic
1024985437 7:55189848-55189870 GGGAGTTCACACAGCCAAGAAGG + Intronic
1028231291 7:88309308-88309330 GGGTGTGCACCCATGGAAGAAGG + Intergenic
1028816436 7:95151555-95151577 GGGTTTTGACAAATGTATGATGG - Intronic
1030157945 7:106475823-106475845 TGGTGTTGAAAAATGGAAGAGGG - Intergenic
1030177575 7:106670825-106670847 GGGTCTCTAAAAATGCAAGAAGG - Intergenic
1032042353 7:128573869-128573891 GGGTGTTCCCAAAAACAATAGGG - Intergenic
1033434251 7:141318371-141318393 GGTTGTTCACATATCCAAGCTGG + Intronic
1034401858 7:150867168-150867190 GGGTGTTCTCACACACAAGAAGG + Intergenic
1036170892 8:6483518-6483540 GGGTTTTCACAAAGGCATGAAGG + Intronic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1037185279 8:16055336-16055358 GGGTATTAACAGATTCAAGATGG - Intergenic
1037828663 8:22175731-22175753 TGGTGTTCCCAAGGGCAAGAAGG - Intronic
1038301686 8:26356285-26356307 TGCTGTTCACAAATGCCTGATGG + Intronic
1041788117 8:61658565-61658587 TGGTTTCCACAAATGCAAAAAGG + Intronic
1043292453 8:78619898-78619920 GGGTTTTAACAAATGCATAATGG + Intergenic
1046779635 8:118201319-118201341 TGGTGTTCACTAATGCTAGAGGG - Intronic
1046869991 8:119195522-119195544 TGGTGTTTACAACGGCAAGAGGG - Intronic
1047681599 8:127259255-127259277 GGGTGTTCACATAGGCTAAATGG - Intergenic
1048838131 8:138540868-138540890 GGTTCTTCACAGATGCAAGGAGG + Intergenic
1049390700 8:142368826-142368848 GGGTGTTCACAAATGCCCTGGGG - Intronic
1050974749 9:11923841-11923863 TAGTGTTCATAAATGCAAGCAGG - Intergenic
1051497710 9:17743553-17743575 GTGTGTTCACAAAAGAGAGAGGG - Intronic
1052788170 9:32849317-32849339 AGGTGATGATAAATGCAAGAAGG - Intergenic
1053780718 9:41603872-41603894 GGGTGTTCTCACATGTGAGATGG - Intergenic
1054168662 9:61814029-61814051 GGGTGTTCTCACATGTGAGATGG - Intergenic
1054668869 9:67766782-67766804 GGGTGTTCTCACATGTGAGATGG + Intergenic
1055696758 9:78893252-78893274 TGGGGATCACAAATGCAAGGCGG + Intergenic
1056316171 9:85392539-85392561 TGATGTTCACAGATGCAAAAAGG + Intergenic
1057134295 9:92676210-92676232 CTGTGTTTAGAAATGCAAGATGG + Intergenic
1057436996 9:95049854-95049876 GAGTCTTCAAAAATGCAAAATGG - Intronic
1057887016 9:98837608-98837630 TAGTGTTCCTAAATGCAAGAAGG - Intronic
1058505857 9:105665455-105665477 TGGTGTACAAAAATGCAAGCAGG - Intergenic
1058624475 9:106920392-106920414 ATGTGTACACAAAAGCAAGATGG + Intronic
1059321182 9:113471338-113471360 GGGTGTTTTCAAATTCCAGAGGG - Intronic
1061819900 9:133221383-133221405 GGGTGTGCACAGATGCAGGGAGG + Intergenic
1062240756 9:135536565-135536587 GGGTGTGCACAGATGCAGGGAGG - Intergenic
1186576240 X:10768974-10768996 GGGTGTGCACACATGTAGGAGGG + Intronic
1186862516 X:13687586-13687608 GGCTGTTCCAAAATGTAAGAAGG - Intergenic
1189147731 X:38672599-38672621 TGGTGTTCATACATGCACGAGGG - Intronic
1189302945 X:39965939-39965961 GGGTGTTCAGAGATGCCAGCTGG - Intergenic
1192705127 X:73521151-73521173 GAGTGTTGACAAATGCAAACAGG - Intergenic
1194129221 X:90059404-90059426 GGGTTTTCAAAAGTGTAAGAAGG + Intergenic
1198601408 X:138287942-138287964 GGGAGTTCACAAAAGAAAGCAGG - Intergenic