ID: 1180599546

View in Genome Browser
Species Human (GRCh38)
Location 22:17007396-17007418
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180599546_1180599561 28 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599561 22:17007447-17007469 GCGTTTTCCTGGGGCCCGGGAGG No data
1180599546_1180599555 18 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599555 22:17007437-17007459 CGAGGTGCCCGCGTTTTCCTGGG No data
1180599546_1180599551 -8 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599551 22:17007411-17007433 GAGGAGGGAAGGGGAGCGAGCGG No data
1180599546_1180599554 17 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599554 22:17007436-17007458 GCGAGGTGCCCGCGTTTTCCTGG No data
1180599546_1180599559 25 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599559 22:17007444-17007466 CCCGCGTTTTCCTGGGGCCCGGG No data
1180599546_1180599553 0 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599553 22:17007419-17007441 AAGGGGAGCGAGCGGGTGCGAGG No data
1180599546_1180599557 24 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599557 22:17007443-17007465 GCCCGCGTTTTCCTGGGGCCCGG No data
1180599546_1180599552 -7 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599552 22:17007412-17007434 AGGAGGGAAGGGGAGCGAGCGGG No data
1180599546_1180599562 29 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599562 22:17007448-17007470 CGTTTTCCTGGGGCCCGGGAGGG No data
1180599546_1180599556 19 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599556 22:17007438-17007460 GAGGTGCCCGCGTTTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180599546 Original CRISPR CCCTCCTCACCCGCCACTCC CGG (reversed) Intronic