ID: 1180599555

View in Genome Browser
Species Human (GRCh38)
Location 22:17007437-17007459
Sequence CGAGGTGCCCGCGTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180599544_1180599555 19 Left 1180599544 22:17007395-17007417 CCCGGGAGTGGCGGGTGAGGAGG No data
Right 1180599555 22:17007437-17007459 CGAGGTGCCCGCGTTTTCCTGGG No data
1180599546_1180599555 18 Left 1180599546 22:17007396-17007418 CCGGGAGTGGCGGGTGAGGAGGG No data
Right 1180599555 22:17007437-17007459 CGAGGTGCCCGCGTTTTCCTGGG No data
1180599543_1180599555 20 Left 1180599543 22:17007394-17007416 CCCCGGGAGTGGCGGGTGAGGAG No data
Right 1180599555 22:17007437-17007459 CGAGGTGCCCGCGTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180599555 Original CRISPR CGAGGTGCCCGCGTTTTCCT GGG Intronic