ID: 1180600492

View in Genome Browser
Species Human (GRCh38)
Location 22:17012286-17012308
Sequence ACATCAGGAGGGCTTCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180600488_1180600492 -10 Left 1180600488 22:17012273-17012295 CCTCTGGGTGTGGACATCAGGAG No data
Right 1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG No data
1180600483_1180600492 11 Left 1180600483 22:17012252-17012274 CCTGGCACAGGTGCTGCTTGGCC No data
Right 1180600492 22:17012286-17012308 ACATCAGGAGGGCTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180600492 Original CRISPR ACATCAGGAGGGCTTCTTGG AGG Intergenic
No off target data available for this crispr