ID: 1180604956

View in Genome Browser
Species Human (GRCh38)
Location 22:17051140-17051162
Sequence GTGCCTTACACAAGATCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180604956_1180604958 24 Left 1180604956 22:17051140-17051162 CCTTGTGATCTTGTGTAAGGCAC No data
Right 1180604958 22:17051187-17051209 AGCACAGTTCAAGACCAGCTGGG No data
1180604956_1180604959 25 Left 1180604956 22:17051140-17051162 CCTTGTGATCTTGTGTAAGGCAC No data
Right 1180604959 22:17051188-17051210 GCACAGTTCAAGACCAGCTGGGG No data
1180604956_1180604957 23 Left 1180604956 22:17051140-17051162 CCTTGTGATCTTGTGTAAGGCAC No data
Right 1180604957 22:17051186-17051208 AAGCACAGTTCAAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180604956 Original CRISPR GTGCCTTACACAAGATCACA AGG (reversed) Intergenic
No off target data available for this crispr