ID: 1180606583

View in Genome Browser
Species Human (GRCh38)
Location 22:17063479-17063501
Sequence GCGGAACTGTCACGTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180606575_1180606583 27 Left 1180606575 22:17063429-17063451 CCCACTAGAAGAGGTGAAATCAA No data
Right 1180606583 22:17063479-17063501 GCGGAACTGTCACGTGCTGCTGG No data
1180606576_1180606583 26 Left 1180606576 22:17063430-17063452 CCACTAGAAGAGGTGAAATCAAA No data
Right 1180606583 22:17063479-17063501 GCGGAACTGTCACGTGCTGCTGG No data
1180606574_1180606583 28 Left 1180606574 22:17063428-17063450 CCCCACTAGAAGAGGTGAAATCA No data
Right 1180606583 22:17063479-17063501 GCGGAACTGTCACGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180606583 Original CRISPR GCGGAACTGTCACGTGCTGC TGG Intergenic