ID: 1180607123

View in Genome Browser
Species Human (GRCh38)
Location 22:17067200-17067222
Sequence CAACGCCCACTGGGAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180607123_1180607126 6 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607123_1180607133 18 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607133 22:17067241-17067263 GTCAGCAGAGGTGGTCTGCCTGG No data
1180607123_1180607134 29 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607123_1180607129 9 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607129 22:17067232-17067254 CAAGCCCCAGTCAGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180607123 Original CRISPR CAACGCCCACTGGGAGCCCT TGG (reversed) Intergenic
No off target data available for this crispr