ID: 1180607126

View in Genome Browser
Species Human (GRCh38)
Location 22:17067229-17067251
Sequence TCCCAAGCCCCAGTCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180607125_1180607126 -4 Left 1180607125 22:17067210-17067232 CCAGTGGGCGTTGTCACAGTCCC No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607121_1180607126 8 Left 1180607121 22:17067198-17067220 CCCCAAGGGCTCCCAGTGGGCGT No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607118_1180607126 13 Left 1180607118 22:17067193-17067215 CCTGACCCCAAGGGCTCCCAGTG No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607116_1180607126 15 Left 1180607116 22:17067191-17067213 CCCCTGACCCCAAGGGCTCCCAG No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607122_1180607126 7 Left 1180607122 22:17067199-17067221 CCCAAGGGCTCCCAGTGGGCGTT No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607117_1180607126 14 Left 1180607117 22:17067192-17067214 CCCTGACCCCAAGGGCTCCCAGT No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607124_1180607126 -3 Left 1180607124 22:17067209-17067231 CCCAGTGGGCGTTGTCACAGTCC No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data
1180607123_1180607126 6 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607126 22:17067229-17067251 TCCCAAGCCCCAGTCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180607126 Original CRISPR TCCCAAGCCCCAGTCAGCAG AGG Intergenic
No off target data available for this crispr