ID: 1180607134

View in Genome Browser
Species Human (GRCh38)
Location 22:17067252-17067274
Sequence TGGTCTGCCTGGTTTGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180607123_1180607134 29 Left 1180607123 22:17067200-17067222 CCAAGGGCTCCCAGTGGGCGTTG No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607122_1180607134 30 Left 1180607122 22:17067199-17067221 CCCAAGGGCTCCCAGTGGGCGTT No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607125_1180607134 19 Left 1180607125 22:17067210-17067232 CCAGTGGGCGTTGTCACAGTCCC No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607127_1180607134 -1 Left 1180607127 22:17067230-17067252 CCCAAGCCCCAGTCAGCAGAGGT No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607132_1180607134 -9 Left 1180607132 22:17067238-17067260 CCAGTCAGCAGAGGTGGTCTGCC No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607130_1180607134 -7 Left 1180607130 22:17067236-17067258 CCCCAGTCAGCAGAGGTGGTCTG No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607131_1180607134 -8 Left 1180607131 22:17067237-17067259 CCCAGTCAGCAGAGGTGGTCTGC No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607128_1180607134 -2 Left 1180607128 22:17067231-17067253 CCAAGCCCCAGTCAGCAGAGGTG No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data
1180607124_1180607134 20 Left 1180607124 22:17067209-17067231 CCCAGTGGGCGTTGTCACAGTCC No data
Right 1180607134 22:17067252-17067274 TGGTCTGCCTGGTTTGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180607134 Original CRISPR TGGTCTGCCTGGTTTGACAC TGG Intergenic
No off target data available for this crispr