ID: 1180607279

View in Genome Browser
Species Human (GRCh38)
Location 22:17068234-17068256
Sequence AAACCTGAAGCCCAGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180607279_1180607283 30 Left 1180607279 22:17068234-17068256 CCTGTCACCTGGGCTTCAGGTTT 0: 1
1: 0
2: 0
3: 19
4: 169
Right 1180607283 22:17068287-17068309 AAACAGAGCTACAGCCTGAGTGG 0: 1
1: 0
2: 2
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180607279 Original CRISPR AAACCTGAAGCCCAGGTGAC AGG (reversed) Intergenic
900707118 1:4087761-4087783 AAACCACAAGCCCAGCTGAGTGG - Intergenic
903933302 1:26877043-26877065 AATCCTGACGCCCAGGCTACTGG - Exonic
904754621 1:32761256-32761278 CAACCTGAGTCTCAGGTGACTGG - Intronic
905947554 1:41916811-41916833 AATCCTGAAGCCAAGGTAATAGG - Intronic
907746346 1:57217622-57217644 AAACCTCCAGTCTAGGTGACTGG + Intronic
910345022 1:86226840-86226862 AAACATTAAGCCCAAGTGAATGG + Intergenic
914898644 1:151698814-151698836 AAAACTGAAGCCCAGCTCACTGG - Exonic
920513898 1:206570001-206570023 AAACCTGGAGGCCATGTCACTGG - Intronic
920722731 1:208402672-208402694 AAAAATGAAGTCCAGGTGTCAGG - Intergenic
923500570 1:234560478-234560500 AAATCTGAATCTCAGGGGACAGG - Intergenic
1063578033 10:7279314-7279336 TAACAAGAAGCCCAGGTGCCAGG + Intronic
1065623583 10:27608440-27608462 AAACCTGAAATTCAGGTGAAAGG + Intergenic
1068403774 10:56563974-56563996 AACCCTGAACCCCAGGCTACAGG + Intergenic
1069328197 10:67258026-67258048 TAATCTGAAACCCAGGTGACTGG - Intronic
1069387452 10:67896938-67896960 ATCACTTAAGCCCAGGTGACTGG + Intronic
1069853211 10:71423903-71423925 GAACCTGCAGTCCAGGTGTCGGG + Intronic
1070640326 10:78164231-78164253 GCCCCTGAAGCCCAGGTGCCTGG - Intergenic
1071366976 10:84909407-84909429 AAACCAGAAGCCAAGGTTCCAGG + Intergenic
1071887821 10:89969866-89969888 AGATCTGAAGCTCAGGGGACAGG + Intergenic
1072200662 10:93155782-93155804 AAGCCTTAAGCATAGGTGACTGG + Intergenic
1075722800 10:124597355-124597377 GAAGCTGAAGGCCAGGTGAGGGG - Intronic
1075913576 10:126147288-126147310 CAGCCTGAAGCCCAGGTGAGAGG - Intronic
1076595329 10:131621604-131621626 ACAGCTGAAGCCCAGGAGACAGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1079469104 11:20761280-20761302 AAGTCTTAAGCCCAAGTGACTGG - Intronic
1079532067 11:21466208-21466230 CTACCTGAAGCCCTGGTGACAGG + Intronic
1081848148 11:46255602-46255624 AAACCTGAAGCCAAGGCGGGTGG - Intergenic
1081878971 11:46431457-46431479 AAAGCAGAAGCCAAGGTGATGGG - Intronic
1082787041 11:57322941-57322963 GATCCTGAAGCTCATGTGACAGG - Intronic
1083048312 11:59755586-59755608 CATCCTGAAGCCCAGGCGCCCGG - Exonic
1084928120 11:72530621-72530643 ACACCTGATGCCCAGGAGAATGG - Intergenic
1090052514 11:123392156-123392178 CAACCAGAAGCCCATGTGACTGG + Intergenic
1091262057 11:134242434-134242456 AAACCTGATGCTCAGCTCACAGG - Intronic
1091719061 12:2799230-2799252 GTACCTCAAGCCCAGGTGAGGGG + Exonic
1092086301 12:5765278-5765300 AAAGCTGAAACCCAGGTACCCGG + Intronic
1092642016 12:10522861-10522883 AAACATGAAGTCCAGGTGTAGGG - Intronic
1098523961 12:71465185-71465207 AATCCTGAAGCAGAGGTAACTGG + Intronic
1100156085 12:91802046-91802068 ATAGCTGAAGCTCAGGAGACAGG + Intergenic
1101723842 12:107373736-107373758 GACCCTGGAGCCCAGGTGTCTGG + Intronic
1102346525 12:112164325-112164347 AACCCTGATCCCCAGGTGGCTGG + Intronic
1104358070 12:128105954-128105976 AAGCCTTAAGCCCAGGGGTCTGG - Intergenic
1105576583 13:21658811-21658833 ACACCTGCAGCCCAGGTTTCTGG + Intergenic
1106132464 13:26951661-26951683 ACAGGTGAAGCCCAGGTGACAGG + Intergenic
1107684850 13:42886572-42886594 AAACCTGACTCGCAGGTGACTGG - Exonic
1108036411 13:46294556-46294578 GAACCTGCAGCCCAGGTTCCTGG - Intergenic
1108131856 13:47310313-47310335 AAACCTGAAAGCCAGGAGGCTGG + Intergenic
1109364323 13:61336011-61336033 ATACCTGAAACTAAGGTGACTGG - Intergenic
1109958651 13:69602806-69602828 AACCCTGAACCCCAGGTTCCAGG + Intergenic
1110920654 13:81080015-81080037 AAAGCAGAAGCCCAGTGGACTGG + Intergenic
1112389627 13:98971145-98971167 AAAACTGAAGCCCAGGAGGGTGG + Intronic
1113378771 13:109785432-109785454 GAACCTGAAGCCCAAGGGTCTGG - Exonic
1113697653 13:112357635-112357657 AAAGCTGAAGCCTGGGTGAGTGG + Intergenic
1113976900 13:114234769-114234791 CAACCAGAAGCCCACGTGCCAGG + Intergenic
1115267957 14:31521056-31521078 TGACCTGAAGCCTAGATGACTGG - Intronic
1116257841 14:42580264-42580286 AAACCTGAAGTCCTGGTGTTGGG + Intergenic
1117996157 14:61480030-61480052 AAATCTCAAGGCCAGGAGACCGG - Intronic
1118496894 14:66316024-66316046 ACACCTGAAGCACAGGTGGCAGG - Intergenic
1118695930 14:68385180-68385202 GAAGCTGAGGCCCAGCTGACAGG - Intronic
1118901478 14:69989861-69989883 AAGCCAGGAGCCCAGGTGCCCGG + Intronic
1119159066 14:72438186-72438208 AAGAGTGAAGCTCAGGTGACAGG + Intronic
1119641453 14:76318205-76318227 AAACCTGGAGCCCAGGTGTTGGG - Intronic
1119754270 14:77103733-77103755 AAGACTGAAGCCCAGGAGAGAGG - Intronic
1119910599 14:78346110-78346132 AGACCTGAAGCACGGGTGATGGG + Intronic
1120553167 14:85896625-85896647 AAACCTGAAGCCCATAGGTCAGG + Intergenic
1120693306 14:87617436-87617458 AAACCTGACACCTAGATGACAGG + Intergenic
1121439879 14:93941937-93941959 AAACCTGAAGCCCAGGCTTGGGG + Intronic
1123410266 15:20052936-20052958 AAAGCTGAGGCCCTGGTGAAAGG - Intergenic
1123427043 15:20181015-20181037 AGTCCTGAAGACCATGTGACAGG - Intergenic
1123519600 15:21059643-21059665 AAAGCTGAGGCCCTGGTGAAAGG - Intergenic
1123536272 15:21187524-21187546 AGTCCTGAAGACCATGTGACAGG - Intergenic
1125013136 15:34902231-34902253 AAACATGAAAAACAGGTGACTGG + Intronic
1127267233 15:57372154-57372176 CAACCTGAAGCTCAGGTAGCTGG - Intergenic
1127883489 15:63178621-63178643 ATACCTTGAGCCCAGGTGAGAGG + Intergenic
1128543968 15:68555186-68555208 AAACCTCCTGCCCAGGTGACTGG + Intergenic
1128703193 15:69819336-69819358 AAACCTGAATCACTGGTGAGTGG - Intergenic
1129605444 15:77022816-77022838 AGGCCTGCAGCCCAGGGGACAGG + Intronic
1129925956 15:79364591-79364613 AACCCTGAACCCCAGGTTCCAGG + Intronic
1132073136 15:98797352-98797374 AAACCTGATGCCCGGGTGTTTGG + Intronic
1133336846 16:5011840-5011862 ACACCGCATGCCCAGGTGACAGG - Intronic
1133541625 16:6761212-6761234 AAATTTGAAGCCCAGGTAATTGG + Intronic
1136857255 16:33668821-33668843 AGTCCTGAAGACCATGTGACAGG + Intergenic
1136924336 16:34357966-34357988 AAACCTGCAGCTCAGCTGGCTGG - Intergenic
1136980237 16:35053840-35053862 AAACCTGCAGCTCAGCTGGCTGG + Intergenic
1141640390 16:85337662-85337684 AGATGTGCAGCCCAGGTGACTGG - Intergenic
1203118828 16_KI270728v1_random:1517312-1517334 AGTCCTGAAGACCATGTGACAGG + Intergenic
1144165210 17:12604113-12604135 AAACCTGGACCCCTGGGGACAGG + Intergenic
1145956459 17:28858224-28858246 GAACCTTAAGCCCAGTTTACAGG + Intronic
1146529916 17:33599735-33599757 AGACCTGAAGCCCAAGGAACAGG + Intronic
1148822565 17:50368046-50368068 GAGACTGGAGCCCAGGTGACAGG - Exonic
1151127814 17:71864238-71864260 CAACCAGAATCCCAGCTGACTGG + Intergenic
1152645811 17:81468105-81468127 AACCCTGACCCCCAGGTGCCTGG - Intergenic
1152704003 17:81833512-81833534 AAACGTGACTCCCAGGTGAGGGG - Exonic
1161004732 19:1929523-1929545 GAACCTGAAGCCCGGGAGCCAGG - Intergenic
1162399961 19:10439675-10439697 AAATCTGAGGCCCAGGAGGCGGG + Intronic
1162728778 19:12705454-12705476 AATGCAGAAGCACAGGTGACGGG + Intronic
1164845822 19:31431940-31431962 TCAGCTGAAGCCCAAGTGACTGG + Intergenic
926653892 2:15377542-15377564 GAACCTGAGGCCCTGATGACTGG + Intronic
928224029 2:29432072-29432094 ACCCCTGAAGCCTAGGTTACAGG + Intronic
928294804 2:30073362-30073384 AACCCTGAAGCCCAGTTGATGGG + Intergenic
928678212 2:33671344-33671366 AAACATGCTGTCCAGGTGACTGG - Intergenic
929403273 2:41610725-41610747 AAAACTGAAACTCAGGAGACAGG + Intergenic
930019548 2:46993198-46993220 AAACCGGAAGCCCAAGTTGCTGG + Intronic
931399184 2:61914931-61914953 AAACATGAGGCCCAGGTGGGTGG - Intronic
931714616 2:65019330-65019352 AGCCCTGGAGCCCAGGTGCCTGG + Intronic
933415426 2:81981550-81981572 CAACCTGAAGCTGAGCTGACAGG - Intergenic
936497919 2:113038677-113038699 AAGCCTGAAGCTCAGATGGCAGG + Intronic
936677138 2:114728468-114728490 AAACCTTAATCCTAGGTGACAGG + Intronic
938163271 2:129005279-129005301 TAAGCTGCTGCCCAGGTGACGGG + Intergenic
939062632 2:137441612-137441634 AAACCTGCAGCCCAGTTAAGGGG + Intronic
939881929 2:147640891-147640913 TATCCTGAAGACCTGGTGACTGG + Intergenic
944606280 2:201354492-201354514 AGGCCTGAAGAGCAGGTGACAGG + Intronic
948629492 2:239293029-239293051 GAACCTGAAGGCCAGGTGGGTGG - Intronic
948994796 2:241572839-241572861 TCACCTGAACCCCAGGTGAAGGG + Exonic
948994846 2:241573001-241573023 TCACCTGAACCCCAGGTGAAGGG + Exonic
1168994565 20:2123411-2123433 AAATCTGAAGCGCAGGTCAAGGG - Intronic
1169812819 20:9625842-9625864 AAATCTGAAGCGCAGCTGATGGG + Intronic
1171052425 20:21872286-21872308 AAGCATGAAGTCCAGATGACTGG + Intergenic
1173864144 20:46303445-46303467 CAGCCTGAATCCCAGCTGACAGG - Intronic
1174204099 20:48827159-48827181 AAACCTGAAGCTCAGAGGAGGGG - Intronic
1174479237 20:50819313-50819335 ACACCTCAAGCCCAGGTTACTGG - Intronic
1179523560 21:41960886-41960908 AAAACTGTAGCCCAGAAGACAGG - Intergenic
1180607279 22:17068234-17068256 AAACCTGAAGCCCAGGTGACAGG - Intergenic
1181164480 22:20976068-20976090 AAGAATGAAGCCCAGGTGGCAGG + Intronic
1183175830 22:36224084-36224106 AAACATGATGACCAGGTGAGGGG - Intergenic
1183448704 22:37878177-37878199 AGACCCCAAGCCCAGGGGACAGG - Intronic
1183939958 22:41288410-41288432 AAACCTGAAGCACCTATGACAGG - Intergenic
1184057276 22:42060879-42060901 AAATCTGAAGCCCAGGCGGGTGG + Intronic
1184183451 22:42847387-42847409 ACTCCTGCAGCCAAGGTGACAGG + Intronic
1184679738 22:46063926-46063948 GAAACTGAGGCCCAGGTGAGTGG - Intronic
1185400538 22:50613351-50613373 AGGCCTGCAGCTCAGGTGACTGG - Intronic
949369082 3:3315548-3315570 AAAACTGAAGCCCAGGGGTCAGG + Intergenic
949391287 3:3565406-3565428 AAACCCAAAGCCTTGGTGACAGG - Intergenic
952160334 3:30687184-30687206 AAGCCTGAGGCCCCGGTGAAGGG + Intronic
955405769 3:58624803-58624825 AAAGTTGAAGCAGAGGTGACTGG - Intronic
961316380 3:126038518-126038540 AAGTCTGAAGCCCAGCAGACAGG - Intronic
961877943 3:130038387-130038409 AAACATTGAGCCCAGGGGACCGG + Intergenic
962385567 3:134929714-134929736 AAATCTGAAGTCAAGGTGCCAGG - Intronic
969360876 4:6663115-6663137 AGACCTGAATGCCAGGTGGCAGG - Intergenic
969512631 4:7628132-7628154 CCACCTGAAGCCCAGGAGCCTGG - Intronic
970502625 4:16693664-16693686 AAACCTGAAGCACAGCAGAGAGG + Intronic
970867917 4:20780359-20780381 AACACTGAAGCTCAGGTGAGTGG + Intronic
975195357 4:71518156-71518178 ATGCCTGAAGCCAAAGTGACTGG + Intronic
977181343 4:93879036-93879058 AAGCCTGAAGCCCAGGAGAAAGG - Intergenic
978649974 4:110990485-110990507 AAACCTGATGAACAGGTGATAGG + Intergenic
982186356 4:152805468-152805490 ATACCTGTAGCTCTGGTGACTGG + Intronic
986029222 5:3880039-3880061 GATCCTCAAGCCCAGGTGATGGG - Intergenic
986748457 5:10763828-10763850 AAACCTGGAGAACAGGTCACAGG - Intergenic
988916002 5:35893568-35893590 AGTCTTGAGGCCCAGGTGACAGG + Intergenic
988991300 5:36673481-36673503 GAACTTGAAGCCCATGTGGCAGG - Intronic
989294310 5:39806303-39806325 AAAGATGAAGCCCAGCTGAGTGG + Intergenic
990327245 5:54690657-54690679 AAACCTGAAGCCCCACTCACTGG + Intergenic
993407918 5:87535170-87535192 AAAACTGAAGACCAGGTAATGGG - Intergenic
998147766 5:139740021-139740043 CAACCTGTAGCCCAGGGCACGGG - Intergenic
998364572 5:141620992-141621014 ACACCTGAATCCCAGATGATGGG - Exonic
998754597 5:145362301-145362323 AAACCTGAAGGCCAGGTATGAGG - Intergenic
999600181 5:153253930-153253952 TAACCTGAAGTCCAGGTCCCTGG + Intergenic
1000244368 5:159437054-159437076 AAATCTGAAGGCCAGGTAAGGGG + Intergenic
1004586183 6:17002975-17002997 GAAGCTGAACCCCAGGTCACAGG + Intergenic
1005824097 6:29622091-29622113 AAACCTGAAGGTCAGATGGCTGG - Exonic
1005841265 6:29745942-29745964 AAACTTGTAGGCCAGGTGCCAGG + Intergenic
1007325845 6:41058996-41059018 AAACCTGAAACCCAAGGGAGAGG - Intronic
1008017057 6:46532343-46532365 AAACTTGAAACCCTGGTGAATGG + Intergenic
1010856105 6:80842136-80842158 GAACCTGAAGCCCAGATAACTGG - Intergenic
1014474072 6:121851099-121851121 AATCCTGAATCCCAGTTGAGAGG + Intergenic
1016799069 6:148150166-148150188 AAACCTGGAACCCAGGAAACAGG - Intergenic
1018582228 6:165317239-165317261 AGACCTGAAGTCCTGGTTACTGG + Intergenic
1018849752 6:167578457-167578479 ACACCTAAAGCCCTGGTGGCCGG + Intergenic
1023988900 7:45116236-45116258 AAACCTGAAGAGCAGGTCATGGG + Intergenic
1027188153 7:75983943-75983965 AGGCCTGAAGCCCCGGTGCCTGG + Intronic
1028959992 7:96737958-96737980 AATCCTGAAGCACAGTAGACAGG + Intergenic
1032497534 7:132373953-132373975 CAACCTGAGGCTCAGGTGGCCGG + Intronic
1032578528 7:133081722-133081744 AGGCCAGAAGCCCAGGTGTCTGG - Intronic
1034882688 7:154774545-154774567 AAACCTGAAGCCCAGCATCCAGG - Intronic
1036570656 8:9977290-9977312 TAACCAGAAGGCCAGGAGACAGG + Intergenic
1036919937 8:12842622-12842644 CAGCCTGGAGCCCAGGTTACAGG - Intergenic
1042631212 8:70818857-70818879 AGACCTGAGACCCAGATGACTGG - Intergenic
1046266404 8:111836987-111837009 AACTCTGAAGCCCGGGTCACTGG - Intergenic
1047961938 8:130017010-130017032 ATTCCTGAAGTCCAGGTGAGGGG - Intronic
1049008930 8:139874651-139874673 AAGCCTGGAGCCCAGGTCACAGG + Intronic
1050361001 9:4831044-4831066 GAAACTGAGGCCCAGGAGACAGG + Intronic
1051594238 9:18808234-18808256 AAATCTGAATCTCAGGTGACAGG - Intronic
1052076726 9:24151455-24151477 AAAGTGGAAGCTCAGGTGACTGG + Intergenic
1055563193 9:77542689-77542711 CCACCTGAAGGCCAGGGGACTGG - Intronic
1060214507 9:121730579-121730601 ATACCTGAAGCCTAGGTCCCTGG - Intronic
1060442280 9:123652840-123652862 AAGACTGAAGCCCAGGCTACAGG - Intronic
1061352116 9:130073712-130073734 AAACTTGAAGCCCAGAGGCCTGG + Intronic
1061605059 9:131703634-131703656 AACTCTGGAGCCCAGGTGCCAGG - Intronic
1189480582 X:41389581-41389603 AAACCAGAAGCCAAGGTCTCTGG + Intergenic
1197851034 X:130860396-130860418 AAACCTGGAGCACAGAGGACAGG - Intronic