ID: 1180609362

View in Genome Browser
Species Human (GRCh38)
Location 22:17085514-17085536
Sequence GAACTCCGCGGCCCGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180609362_1180609384 24 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609384 22:17085561-17085583 CCAGGCCGGAGGGGCGGCCAGGG No data
1180609362_1180609373 -6 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609373 22:17085531-17085553 GAGTTCGGGGAAGGAGGGCGCGG No data
1180609362_1180609382 23 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609382 22:17085560-17085582 GCCAGGCCGGAGGGGCGGCCAGG No data
1180609362_1180609374 0 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609374 22:17085537-17085559 GGGGAAGGAGGGCGCGGCGCTGG No data
1180609362_1180609377 10 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609377 22:17085547-17085569 GGCGCGGCGCTGGGCCAGGCCGG No data
1180609362_1180609379 14 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609379 22:17085551-17085573 CGGCGCTGGGCCAGGCCGGAGGG No data
1180609362_1180609375 1 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609375 22:17085538-17085560 GGGAAGGAGGGCGCGGCGCTGGG No data
1180609362_1180609376 6 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609376 22:17085543-17085565 GGAGGGCGCGGCGCTGGGCCAGG No data
1180609362_1180609381 18 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609381 22:17085555-17085577 GCTGGGCCAGGCCGGAGGGGCGG No data
1180609362_1180609380 15 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609380 22:17085552-17085574 GGCGCTGGGCCAGGCCGGAGGGG 0: 1
1: 0
2: 1
3: 54
4: 569
1180609362_1180609378 13 Left 1180609362 22:17085514-17085536 CCTCCGCCCGGGCCGCGGAGTTC No data
Right 1180609378 22:17085550-17085572 GCGGCGCTGGGCCAGGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180609362 Original CRISPR GAACTCCGCGGCCCGGGCGG AGG (reversed) Intronic