ID: 1180610717

View in Genome Browser
Species Human (GRCh38)
Location 22:17095977-17095999
Sequence CACCCTCCTCTCTCTTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180610717_1180610724 16 Left 1180610717 22:17095977-17095999 CCCTCTCAAGAGAGAGGAGGGTG 0: 1
1: 0
2: 4
3: 32
4: 241
Right 1180610724 22:17096016-17096038 ACTCACACCAGTCACTTTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180610717 Original CRISPR CACCCTCCTCTCTCTTGAGA GGG (reversed) Intronic
900714229 1:4133659-4133681 CAGCCTCCTCACTCTTAAGCGGG + Intergenic
901228544 1:7629217-7629239 CATCCTTCTCTCTCTTGCCAGGG - Intronic
901793454 1:11666771-11666793 CACCCTCCTGTTTTCTGAGATGG + Intronic
902624984 1:17671327-17671349 CTCCCTCCCTTCTCTTGGGAGGG - Intronic
902679658 1:18034020-18034042 GACCCTGCTCACTCTTGGGAGGG - Intergenic
903131798 1:21284313-21284335 CACAGTCCCCTCTCCTGAGATGG - Intronic
904593091 1:31626198-31626220 TTCCCTCCTCCCCCTTGAGAAGG + Intronic
904755302 1:32765623-32765645 CCCCCTCCTCTGTCTGGAGCCGG + Intronic
905627020 1:39495813-39495835 CACCTGCCTCTCTGCTGAGATGG - Intronic
905669916 1:39784958-39784980 CACCTGCCTCTCTGCTGAGATGG + Intronic
905882685 1:41474906-41474928 CACTCTGCTCTCCCCTGAGAGGG + Intergenic
906210130 1:44008267-44008289 CACCCTACTTTGTCTTCAGATGG + Intronic
906382722 1:45343010-45343032 CACCCACCTGTTTCTTGGGAGGG + Intronic
906722652 1:48020246-48020268 TAGCCTCCTCACTCTTCAGATGG - Intergenic
906805141 1:48773466-48773488 CACCCGCCTATCTCTTCAGTTGG - Intronic
911521016 1:98930910-98930932 CACCTTCCTCCTTCTTGAAAGGG - Intronic
912513519 1:110204053-110204075 CCACCTCCTGTCTCTTGAAATGG - Intergenic
913120961 1:115740368-115740390 ATCCCTCCTCTCTCTTCAGGTGG + Intronic
913158849 1:116127615-116127637 CACTCCACTCTCTCTTGGGAAGG - Exonic
913199836 1:116486821-116486843 AGCCCTCCACTCTCATGAGAGGG - Intergenic
916297297 1:163233756-163233778 CACCCTCCCCACCCTTAAGAAGG - Intronic
918682652 1:187374282-187374304 AACCCTCCTCCCTCTAGAGAGGG + Intergenic
920728578 1:208461382-208461404 CACCCTCCTCTCTGTGGACAAGG - Intergenic
920867206 1:209762975-209762997 CACCCTACTGGCTCTTCAGAAGG + Intronic
921466148 1:215490645-215490667 CACTCTCCTCCCTCCTTAGATGG + Intergenic
922916140 1:229259301-229259323 CTCGATCCTCTCTGTTGAGATGG - Intergenic
923677282 1:236090946-236090968 CAACCACTCCTCTCTTGAGAGGG - Intergenic
924795849 1:247291695-247291717 CTCCCTCCTGTCTCCTCAGAGGG - Intergenic
1066198696 10:33126205-33126227 TACTCTCCTCTGGCTTGAGAAGG - Intergenic
1070832803 10:79430631-79430653 CACCATCCTCTCTCCTGACAGGG - Intronic
1070951533 10:80435207-80435229 CTCCCTCGTTTTTCTTGAGATGG - Exonic
1072370426 10:94761073-94761095 CAGCCTCCTCATTCCTGAGATGG + Intronic
1072689517 10:97562568-97562590 CACCCTCCCCACCCTTGAGAAGG - Intronic
1073130265 10:101183990-101184012 CACCCTCCCCACCCTTAAGAAGG - Intergenic
1073641607 10:105258168-105258190 CACCCTCCACGCTCTCTAGAAGG + Intronic
1074105974 10:110389972-110389994 CACCCTCCTCTCCCTCATGATGG + Intergenic
1074187910 10:111113040-111113062 CATCCTTCTCACTCTTCAGAAGG - Intergenic
1074251840 10:111758442-111758464 CTCTCTCCTCTCTCTGAAGAGGG + Intergenic
1075513773 10:123093514-123093536 CCTCCTCCTCTCCATTGAGAAGG + Intergenic
1076629208 10:131842405-131842427 CATCATCTTCTCTCTGGAGAAGG - Intergenic
1076930602 10:133529254-133529276 AACCCTCCTCTCCCTAGAGAGGG - Intronic
1077513850 11:2988919-2988941 AACCCTGTTCTCTCTTAAGAGGG + Intronic
1079806274 11:24933990-24934012 CACCCTCCCCATCCTTGAGAAGG - Intronic
1079835362 11:25327073-25327095 CACCCTCCCCATCCTTGAGAAGG - Intergenic
1080639346 11:34149723-34149745 CACCATTTCCTCTCTTGAGAGGG - Intergenic
1081747688 11:45484469-45484491 CGCCATCCTCTCTCCTGACAAGG - Intergenic
1083639531 11:64138039-64138061 CACCATCCTCTGCCTTCAGAGGG + Intronic
1083792878 11:64997136-64997158 CACCATCCTCTTTCCAGAGAAGG - Intergenic
1085229257 11:74950554-74950576 CACACTCTTCTCTTGTGAGAGGG + Intronic
1085270869 11:75269173-75269195 AAGCCTCCTCTTTCCTGAGAAGG + Intronic
1086701075 11:89901002-89901024 CACCCTCCTCTGTCCTGTGCCGG - Intergenic
1086705092 11:89943525-89943547 CACCCTCCTCTGTCCTGTGCCGG + Intergenic
1089203488 11:116739835-116739857 CACCCACCTCTCCCCTGACAAGG + Intergenic
1089429395 11:118409612-118409634 CACCCTGTTCTCTCTTGGGGAGG - Exonic
1089803708 11:121063161-121063183 CACCTCCCTATATCTTGAGATGG - Intronic
1090469666 11:126969114-126969136 CGCCCTCCTCTGTCTTGAGCAGG - Intronic
1091396375 12:156265-156287 CAGCCTCCTCCCTTTTCAGAAGG + Intronic
1093925849 12:24907655-24907677 CACCCTCCCCACCCTTGAGAAGG + Intronic
1096923267 12:55112847-55112869 CATCCTCTTTTCTCATGAGAGGG + Intergenic
1097541241 12:60946300-60946322 CACCCTCCATTCTTTGGAGAGGG + Intergenic
1101662566 12:106778914-106778936 CACCCTCCATTTTTTTGAGATGG + Intronic
1101992485 12:109498647-109498669 CCCTCCCTTCTCTCTTGAGATGG - Intronic
1102686832 12:114731532-114731554 TACACTTCTCTCTTTTGAGATGG + Intergenic
1103745125 12:123117506-123117528 CAGCCTCCTCACTCTACAGATGG - Intronic
1103850324 12:123928732-123928754 ATCCCACCTCTCTCTTTAGAGGG + Exonic
1106196416 13:27497946-27497968 CCCCTGCTTCTCTCTTGAGAGGG + Intergenic
1107408296 13:40135749-40135771 CATTATCGTCTCTCTTGAGAAGG - Intergenic
1108625439 13:52224186-52224208 CACCCTCCCCTCTCTTGGGAGGG - Intergenic
1108660621 13:52582224-52582246 CACCCTCCCCTCTCTTGGGAGGG + Intergenic
1109045440 13:57405512-57405534 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1111364473 13:87223775-87223797 CACCCTCCTCCTTCTTGGGGAGG + Intergenic
1111389538 13:87574709-87574731 CACCTTCAGCTCTCTGGAGAAGG - Intergenic
1114191109 14:20440125-20440147 CACTCTCCTGCCTCTTTAGAGGG + Intergenic
1114496619 14:23137375-23137397 CAGCCACCTCTCTGTTGAGCAGG + Intronic
1114621697 14:24099897-24099919 CACCCACCCCTGTCCTGAGATGG - Intronic
1116576433 14:46581743-46581765 CACCCTGCTCTGTCTGGTGAAGG + Intergenic
1117974781 14:61286770-61286792 CACCCTCTTTTTTTTTGAGATGG - Intronic
1118362004 14:65064687-65064709 CACATGCCTCTCCCTTGAGAGGG + Intronic
1119420984 14:74507978-74508000 CACTCTCCACTCTCTGGGGAGGG + Exonic
1121093684 14:91201015-91201037 CACCCTCCCCACCCTTGAGAAGG - Intronic
1122051485 14:99063939-99063961 CATCCGCCTCCCTCTTCAGATGG - Intergenic
1125268810 15:37915513-37915535 CACCCTCTTCTCCCATGGGAGGG + Intergenic
1125646414 15:41276363-41276385 CAGCCACCTCTGTCTTCAGATGG - Intronic
1128681925 15:69658695-69658717 CTGCCTCCTCTCTCTCAAGAAGG + Intergenic
1130533546 15:84766523-84766545 CACCCAGATCTCTGTTGAGAGGG + Intronic
1131251939 15:90836758-90836780 CACCCACCTATCTCTTAAGCAGG + Intergenic
1131971989 15:97902748-97902770 CTCCCTCGTAGCTCTTGAGAAGG - Intergenic
1132292663 15:100714192-100714214 AGGCCTCCTCTCTCTTCAGAGGG + Intergenic
1132925475 16:2427155-2427177 CACTCACCTCTCTTCTGAGACGG + Intergenic
1134052089 16:11144481-11144503 CACCCTCCCCTCAGCTGAGAGGG + Intronic
1136005948 16:27329135-27329157 CTCCCTCCTCTCTCTTGCCCTGG + Intronic
1137714526 16:50590418-50590440 CATCCTTCTTTTTCTTGAGATGG + Intronic
1142131302 16:88432775-88432797 AACCCTCCTCTCTGTTCACAGGG - Exonic
1142313896 16:89330956-89330978 CACCTTCCTTTTTCTTGAGACGG + Intronic
1142314031 16:89331948-89331970 CACCACACTCTCTCTTAAGAAGG + Intronic
1143564974 17:7715775-7715797 CACCCCCCTCTCCGTGGAGATGG + Intergenic
1146724771 17:35148152-35148174 CACCATCCTCTCTGGTGTGAGGG + Intronic
1147615280 17:41823688-41823710 CACCCTTCTCCCTCTTGCTAGGG + Intergenic
1149085225 17:52708858-52708880 CACCCTTCTTTCTCTTTAGATGG + Intergenic
1149154342 17:53608348-53608370 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1150070690 17:62147593-62147615 CACCCTCCCCACCCTTGAGGAGG + Intergenic
1150860449 17:68795766-68795788 CACCCTCCCCACCCTTGAGAAGG - Intergenic
1150860776 17:68797884-68797906 CACCCTCCCCACCCTTGAGAAGG - Intergenic
1151803342 17:76390623-76390645 CACCCGCCTCTGACCTGAGAAGG + Exonic
1154260826 18:12831040-12831062 CTCTCTCCTCTCTCTTCACAGGG - Exonic
1155025185 18:21934625-21934647 CAACCACCTCTCTCCAGAGAAGG - Intergenic
1156490102 18:37491114-37491136 CACCCTCTTCTCACCCGAGAGGG + Intronic
1156715682 18:40006961-40006983 CACCCCTCTCTCTCAGGAGAGGG + Intergenic
1157528075 18:48400288-48400310 CACCCTCCTCGAACTTGGGAAGG + Intronic
1157975658 18:52324095-52324117 CACCCTCCTCTCCCTGGAGGTGG - Intergenic
1159449476 18:68582002-68582024 GAAATTCCTCTCTCTTGAGAAGG - Intergenic
1160478477 18:79216396-79216418 CACCCTCCCCTCTCTGAAGTGGG + Intronic
1161711689 19:5852196-5852218 TACCCTCGTCACCCTTGAGAAGG + Intergenic
1162997244 19:14343965-14343987 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1164826856 19:31290311-31290333 CACCCTCCTGGCTCTTGACCGGG + Intronic
1165026486 19:32966357-32966379 CACCTTGGTCTCTCTGGAGATGG + Exonic
1165351829 19:35279837-35279859 CCCCCTCCCCACTCCTGAGATGG - Intergenic
1166296429 19:41892309-41892331 CCCCATTCTCTCTCTTGAGCAGG + Exonic
1166405486 19:42519020-42519042 CAGCATCCTCCCTCTTGACAGGG + Exonic
1166906159 19:46109691-46109713 CACCCTCCCCACCCTTGAGAAGG - Intergenic
1167376800 19:49116638-49116660 CAACCTTCTCTCTCTGGGGAGGG + Intronic
1168258309 19:55179223-55179245 CAGCCTCCCCGCACTTGAGAGGG + Intronic
924985113 2:263930-263952 CACCCTCCCCTCTCAAGAGCTGG - Intronic
925993905 2:9276277-9276299 CACACTCCTCTCTCCTGAGAAGG - Intronic
926755960 2:16236171-16236193 CACCTCCCACACTCTTGAGAAGG + Intergenic
927105095 2:19817370-19817392 CTACTTCCTCTCTCTTGAGAGGG + Intergenic
928590368 2:32808449-32808471 CTCCCTCCTCTCTCTTCTGGTGG + Intronic
930098186 2:47582960-47582982 CACCCTCCCCACCCTTGAGAAGG - Intergenic
930099431 2:47591436-47591458 CACTCTCCCCACCCTTGAGAAGG - Intergenic
933758329 2:85657933-85657955 CACCTTCCCCACCCTTGAGAAGG - Intronic
934057470 2:88263734-88263756 CCCCCTCCTCTCTTTTTAAAGGG + Intergenic
935340275 2:102053484-102053506 CTCCCTCCTCTTTGTGGAGAGGG + Intergenic
936382588 2:111999963-111999985 CACCCTCCCTACCCTTGAGAAGG - Intronic
936497968 2:113039085-113039107 CAGCCTCCTCTCTCTAGATTGGG + Intronic
937064871 2:119010355-119010377 CACCCTCCCCACTCTAGAGTTGG - Intergenic
937483570 2:122290016-122290038 CACCCTTCTCTCTATCCAGAGGG + Intergenic
938549747 2:132369094-132369116 CCCACTCCTTTGTCTTGAGATGG - Intergenic
938661706 2:133493791-133493813 CTCACTCTTCTTTCTTGAGATGG - Intronic
939873214 2:147548049-147548071 CACTCTCCTCCCTCCTGACAAGG + Intergenic
940013359 2:149078212-149078234 CACCCTTGCCTCCCTTGAGAAGG + Intronic
941984598 2:171497890-171497912 CACCCACCCCACCCTTGAGAAGG - Intergenic
942731025 2:179060878-179060900 CACCCTCCCCACCCTTGAGAAGG - Intergenic
943736057 2:191355846-191355868 CACCCTCCTCACAATGGAGATGG + Intronic
945383832 2:209173476-209173498 TACCTTCCCCTCTCTTCAGAGGG + Intergenic
947361308 2:229348234-229348256 CACCCTCCCCTCCCTTCACATGG + Intergenic
947403402 2:229750766-229750788 CAACTCCCTATCTCTTGAGATGG - Intergenic
1168773704 20:431933-431955 CACTCTCCCCTCTCTTGCCAGGG + Intergenic
1169607403 20:7338109-7338131 CACCCTCCAATCTCTGAAGAGGG + Intergenic
1173571685 20:44081253-44081275 CATCCTTCTCTCTTGTGAGAAGG + Intergenic
1174908639 20:54580552-54580574 CATCCTCCTATCTCTTAGGATGG - Intronic
1177409240 21:20708476-20708498 CACCCTATTCTCTCATCAGAAGG + Intergenic
1177712660 21:24799232-24799254 AACCATCCATTCTCTTGAGAAGG - Intergenic
1179047147 21:37856102-37856124 CACCCTCCTGTCTCTGGCCATGG - Intronic
1179437764 21:41374000-41374022 CACCATCCCCTTTCTTGGGAGGG - Intronic
1180170514 21:46055824-46055846 CAGCCTCTTCTCTCTTGAGCGGG - Intergenic
1180610717 22:17095977-17095999 CACCCTCCTCTCTCTTGAGAGGG - Intronic
1181897856 22:26126494-26126516 CATCGTCCTCTCTCCTGTGATGG - Intergenic
1182861093 22:33560036-33560058 CACCCTCCTTTCCCTTGAAGAGG - Intronic
1183314508 22:37129474-37129496 CACTTTCCTCTCTCTGGGGATGG - Intronic
1183829314 22:40409510-40409532 CACCCACCTCTCTCTTCGCAGGG - Exonic
1185128244 22:49023516-49023538 CTGCCTCCTGTCCCTTGAGAGGG - Intergenic
949097675 3:105484-105506 CACCCTACACTCTCTTTAAAAGG - Intergenic
950788906 3:15456719-15456741 GACACTCCTCTCACTTCAGAAGG - Intronic
952472502 3:33671141-33671163 CACCCTCCTCTCACTTAGGTGGG - Intronic
954805670 3:53218577-53218599 CTCCATCATCTCTCCTGAGAGGG - Intergenic
954916206 3:54150425-54150447 CCCCCTTCCCTCTCTGGAGAAGG + Intronic
955037547 3:55283563-55283585 CACCCTTCTACCTCCTGAGAGGG - Intergenic
955100743 3:55847285-55847307 CACCCTCCTTTTTATTGAGAGGG + Intronic
957128883 3:76198250-76198272 CACCCTCCTCCCTCAGGACATGG + Intronic
960136215 3:114108258-114108280 CCCCCATCTCTCTCTGGAGAGGG - Intergenic
960952582 3:123009201-123009223 CACTCTCCACTCTCTGGAGAGGG + Intronic
961594062 3:128002663-128002685 CATCCTGCTCTTTTTTGAGACGG - Intergenic
962074910 3:132071328-132071350 TACCATCCTCACTTTTGAGATGG + Intronic
963315310 3:143752488-143752510 CACCCTTACCTCCCTTGAGATGG - Intronic
965859971 3:173136911-173136933 CCCTGTCCTCTCTCTTGGGAAGG + Intronic
967791595 3:193555190-193555212 CCCGCTCCTCACTCCTGAGAAGG - Intronic
967877959 3:194279683-194279705 CAACCTCCTCTCTCTAGGAAGGG + Intergenic
967901984 3:194464154-194464176 GACCCTTCTCTTTTTTGAGATGG - Intronic
968962605 4:3753074-3753096 CAACCTCCTCTCTCCTCAGCCGG - Intergenic
971138973 4:23902763-23902785 CACCCGCCTCTCTCTTCCAAGGG + Intronic
973122534 4:46540268-46540290 CACCTTCCTCTCTCTCTAAAGGG + Intergenic
975581504 4:75911043-75911065 CACCCTCCCCACCCTTGAGAAGG - Intergenic
975945141 4:79696691-79696713 CACCCTCCCCACCCTTGAGAAGG + Intergenic
976772923 4:88674036-88674058 CACCATTCTCTCTGTTGAGTGGG - Intronic
978232134 4:106412446-106412468 CCCTCTCCCCTCTCTGGAGAAGG + Intergenic
979971584 4:127142354-127142376 CTCCCAGTTCTCTCTTGAGAAGG - Intergenic
980320647 4:131268666-131268688 CACCCTCATATCTCTTCACATGG + Intergenic
982480869 4:155908342-155908364 CACCCTGCTTTCTCTTGCCATGG + Intronic
983706132 4:170661931-170661953 CAACCTTCTCTCTCTTTTGATGG - Intergenic
984021268 4:174487272-174487294 CCCCCTCCACTCTCTTGGGGTGG + Intergenic
985674107 5:1221512-1221534 CACCCACCTCCCTCCTGGGATGG - Intronic
985913714 5:2902163-2902185 CACCCTTCTCTCTCTCAGGATGG - Intergenic
987069920 5:14326510-14326532 CACCTTCCTCTCTGTTCAGAGGG - Intronic
988912030 5:35852839-35852861 CCCCAGCCTCTCTCTTGAGCAGG + Intronic
989469639 5:41800409-41800431 CACCCTTCTCTATCCTGAGAAGG + Intronic
991583772 5:68182492-68182514 CACCCTTCTTTCCCTTGAGCAGG + Intergenic
996391325 5:122965433-122965455 CACCCACATTTCTCTTGGGAGGG - Intronic
999547904 5:152651107-152651129 CACCTTCATCACACTTGAGATGG - Intergenic
999717028 5:154369589-154369611 TACCCTCCTCTCTCTCCAAATGG + Intronic
1000129961 5:158287432-158287454 CATTCTCATCTTTCTTGAGAAGG + Intergenic
1000506828 5:162130808-162130830 CATCCACATCTCTCTTGAGCTGG - Intronic
1002709793 5:181188369-181188391 CCCCCCCCTTTCTTTTGAGATGG - Intergenic
1004441764 6:15661639-15661661 CACCCCCCTTTTTTTTGAGATGG - Intronic
1004855148 6:19742051-19742073 CTTGCTTCTCTCTCTTGAGAAGG - Intergenic
1006412096 6:33879930-33879952 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1006788967 6:36686410-36686432 TACCCCCCTCTGTCTTGTGAAGG + Exonic
1010866417 6:80981395-80981417 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1013079719 6:106801640-106801662 CAACCACCTCACTCTGGAGAGGG - Intergenic
1015089860 6:129342983-129343005 CAGCCTCCTTTTTCTTAAGATGG + Intronic
1018810560 6:167295143-167295165 CACCCTGCTCCCTGGTGAGATGG + Intronic
1020441085 7:8217241-8217263 GACCCTGCTTTCTCTTCAGAGGG + Intronic
1023569938 7:41561503-41561525 CACCCTTCTATGTCTTGAGCTGG + Intergenic
1024036680 7:45512718-45512740 CCCCCTCCCCTCCCTGGAGATGG + Intergenic
1029224478 7:99014886-99014908 GACCCTCCTCACTCTGGAGCCGG - Intergenic
1032094714 7:128932303-128932325 CACCCTCTTCTTCCCTGAGAGGG + Intergenic
1032151175 7:129431397-129431419 CACCCTCCTCTCTCCATAAAGGG - Intergenic
1033603532 7:142908266-142908288 CAACCTCCTTTTTCCTGAGATGG + Exonic
1035276614 7:157751828-157751850 CTCCCTCCTCTCTCTTTAGAAGG - Intronic
1035454147 7:158997953-158997975 CACGCTCCCCTCTCCTCAGAGGG + Intergenic
1036498714 8:9294295-9294317 CACCTTCCTCTCTCTGGATTGGG + Intergenic
1036699419 8:11002178-11002200 CACCCTCCCCAATCCTGAGAGGG + Intronic
1037536852 8:19832694-19832716 CACCCTCCTCTCTCTGCTGGTGG + Intronic
1037564440 8:20105754-20105776 CACCCTCATCTCTGCTGAGTAGG + Intergenic
1037880922 8:22573029-22573051 CACTCTCTTCTCTCTGGGGACGG - Intronic
1038059759 8:23899879-23899901 CTCCCTCCTCTCTCCTGGCATGG - Intergenic
1038313221 8:26461902-26461924 CACCCTCCTCTCTGTAAAGCTGG - Intronic
1039462170 8:37754260-37754282 CACCCTCCTTTCCCTAGAAAGGG - Exonic
1040937237 8:52794521-52794543 CACCCAGCTTTCTCTTGCGAAGG + Intergenic
1040937339 8:52795391-52795413 CACCCAGCTTTCTCTTGCGAAGG - Intergenic
1041351619 8:56952759-56952781 CACCCTCCTCACCCTTCAGTGGG + Intergenic
1042498939 8:69488381-69488403 CACTCTTCTCTTTCCTGAGATGG - Intronic
1042859889 8:73301749-73301771 CACCTTTTTCTTTCTTGAGATGG - Intronic
1043136308 8:76530282-76530304 CCCCCTCCTTTCTGTTGGGAGGG - Intergenic
1043876555 8:85492582-85492604 CACCCTGCTCTGTCCTGAGCAGG + Intergenic
1044254133 8:90039790-90039812 CAGGCTCACCTCTCTTGAGAGGG + Intronic
1044274810 8:90286546-90286568 TACCATCCTCTTTCATGAGATGG + Intergenic
1045377496 8:101589616-101589638 CACCCTCCTGTTTGTGGAGAAGG - Intronic
1047210739 8:122837988-122838010 CACCCTCCTCTCCCCTAAGCGGG - Intronic
1047480017 8:125272955-125272977 CACCCAGCTCCCTCTTGGGAGGG - Intronic
1048050971 8:130815912-130815934 TAGCCTCCCCTCTCATGAGAAGG + Intronic
1048153799 8:131921413-131921435 GACCCCCCTCTCTCTAGATATGG + Intronic
1048384645 8:133900876-133900898 CACCACCCTCTCTCTTGTGCAGG + Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049610091 8:143550911-143550933 CACCCTCCTCACTCTTTATTGGG + Intergenic
1050182714 9:2937394-2937416 AACCCTGGTCTCTCTGGAGAAGG - Intergenic
1051847731 9:21471143-21471165 CTCCCTCCTCTCCCTAGGGAAGG - Intergenic
1053133849 9:35637080-35637102 CACCCTCCCCACCCTTAAGAAGG + Intronic
1053200681 9:36149645-36149667 CAACCCCCTCTCTGTAGAGATGG - Intronic
1053321723 9:37104804-37104826 CAACCTCCTCCCCTTTGAGATGG + Intergenic
1053567523 9:39268946-39268968 CACCCTCTTCTCTTTTGTGTGGG - Intronic
1054129620 9:61350052-61350074 CACCCTCTTCTCTTTTGTGTGGG + Intergenic
1054597011 9:67077517-67077539 CACCCTCTTCTCTTTTGTGTGGG + Intergenic
1055423353 9:76167191-76167213 CACGCTCCTCTATTTCGAGAGGG + Intronic
1056251375 9:84751670-84751692 CTCTCTCCTCCCTCTTTAGATGG + Intronic
1056685009 9:88752153-88752175 CAACCTCTCTTCTCTTGAGAAGG - Intergenic
1056714124 9:89014236-89014258 CAACCTCCTCTCCCCTGACATGG - Intronic
1056797003 9:89665365-89665387 CATCCTCATCTCTCTTGGGTGGG + Intergenic
1057770121 9:97959955-97959977 AACCTTCCTCTATCTTGGGAAGG - Intergenic
1058711299 9:107681767-107681789 CACCCTCATCTCCCAGGAGAGGG + Intergenic
1058733647 9:107874612-107874634 CAACCTCCTCTCTTTTCAGGGGG + Intergenic
1059823232 9:117997267-117997289 CCTCCTCCTCTTTTTTGAGACGG + Intergenic
1061253104 9:129437847-129437869 CAACCCCCTCTCTCTGCAGATGG + Intergenic
1061531156 9:131214360-131214382 CACTCTCCGCTGTGTTGAGATGG + Intronic
1062187246 9:135224501-135224523 CACCGTCCTCCCCCTTGGGAAGG - Intergenic
1185501421 X:599565-599587 CACCCTCCCCACCCTTGAGAAGG - Intergenic
1187126206 X:16456642-16456664 TACCCTCCCCACCCTTGAGAAGG - Intergenic
1187362768 X:18643423-18643445 CACCCTCCCCTCTCTTCACCTGG - Intronic
1187563674 X:20427136-20427158 CATCCTTCTCTACCTTGAGAAGG + Intergenic
1188506022 X:30885800-30885822 CACCCTGTTCTTTCTTGAAAAGG - Intronic
1189910247 X:45803954-45803976 CACTTTCTTCTCTCGTGAGAAGG + Intergenic
1191182479 X:57578142-57578164 CACCCACCACTATCTGGAGAGGG - Intergenic
1192454296 X:71264632-71264654 TACCCTCCCCACCCTTGAGAAGG + Intergenic
1192455525 X:71272543-71272565 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1195879357 X:109576318-109576340 CACCCTCCCCACCCTTGAGAAGG + Intergenic
1196963419 X:121028722-121028744 CAACCTCCTCTATATTCAGATGG + Intergenic
1197610437 X:128632400-128632422 CACACTCCTCTTTCTTAGGAAGG + Intergenic
1197714838 X:129699255-129699277 CTCCCCCCCCTCTCTTTAGACGG + Intergenic
1198035941 X:132801367-132801389 CTCCCTCCTTTCTCTTGTGTTGG + Intronic