ID: 1180612709

View in Genome Browser
Species Human (GRCh38)
Location 22:17108331-17108353
Sequence TCCCCCCACCGCTGAAGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180612707_1180612709 -7 Left 1180612707 22:17108315-17108337 CCTGCGGCTGACCTGATCCCCCC 0: 1
1: 0
2: 3
3: 8
4: 136
Right 1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 192
1180612706_1180612709 -3 Left 1180612706 22:17108311-17108333 CCTGCCTGCGGCTGACCTGATCC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 192
1180612705_1180612709 7 Left 1180612705 22:17108301-17108323 CCTTAGATGGCCTGCCTGCGGCT 0: 1
1: 0
2: 1
3: 10
4: 126
Right 1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180612709 Original CRISPR TCCCCCCACCGCTGAAGCCC AGG Exonic
900162556 1:1231353-1231375 TTCCACCAGAGCTGAAGCCCAGG - Intronic
900422357 1:2561050-2561072 TTCCCCAACCCCTGAAGCCCAGG - Intronic
900597591 1:3489579-3489601 TCCCCCCACTGCTGATGCTCAGG + Intergenic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
902983983 1:20144264-20144286 TCCTCCCACTGCTGCAGCCGGGG + Intronic
904272060 1:29356604-29356626 TCCACCCATCCCTGAAGCCATGG + Intergenic
904793747 1:33043423-33043445 ACCTCCCACTGCTCAAGCCCAGG - Intronic
905928239 1:41767329-41767351 TCCCCCAACCGCTAGAGCTCTGG + Intronic
909496013 1:76279479-76279501 TCCCCCCACCCGCGAAGCTCTGG - Intronic
914431724 1:147624865-147624887 TCCCCCCACAGATGAGGCCCCGG + Exonic
914917978 1:151830080-151830102 CCCCCACATCTCTGAAGCCCTGG - Intronic
916883213 1:169042884-169042906 TCCCCTCTCCCCTGCAGCCCTGG - Intergenic
920519407 1:206612415-206612437 TGCCCCCACGGCTGAGGGCCTGG - Exonic
920872438 1:209805687-209805709 TACCCCCACCGCCGAAGCGGAGG - Intronic
924798538 1:247310288-247310310 TCCCCCCACACCTCAAGACCAGG - Intronic
1063187572 10:3665009-3665031 TGCCACCACTGCTGGAGCCCAGG + Intergenic
1064545752 10:16448533-16448555 GCCCCACACCGCTGGACCCCTGG + Intronic
1066332501 10:34439996-34440018 TCTTCCCACCGCTGAGGCCTGGG - Intronic
1067850573 10:49751435-49751457 TCCCCCAGCCCCTGCAGCCCTGG + Intronic
1069567429 10:69473250-69473272 TCCTCCCATCGCTTGAGCCCAGG - Intronic
1069820261 10:71223102-71223124 TCTCCCCAACCCTGGAGCCCTGG - Intronic
1070449255 10:76541454-76541476 TCGCCCCACCGCTCCAGCCAGGG + Intronic
1071495586 10:86165522-86165544 GCCCACCCCTGCTGAAGCCCAGG + Intronic
1074827269 10:117223590-117223612 TCCACCCACCACAGAAGGCCAGG - Intergenic
1075987898 10:126803825-126803847 TCCCCTCACCGTTGTTGCCCTGG + Intergenic
1076679633 10:132165063-132165085 TCCTCCCATCACTGAAGCCTGGG + Intronic
1076795164 10:132794752-132794774 ACCCCCCCCCGGTGAGGCCCTGG - Intergenic
1077333866 11:1994765-1994787 GCCCCAGACCCCTGAAGCCCGGG - Intergenic
1078091675 11:8268199-8268221 TCCCGCCGCCGCCGAAGCCCGGG + Intronic
1080551343 11:33376229-33376251 TCCCGCCGCCGCTGCAGCCTCGG - Intergenic
1083299820 11:61734534-61734556 TGCACCCAACACTGAAGCCCTGG - Intronic
1083958454 11:66000252-66000274 GCTCCCCACCCCTGCAGCCCTGG - Intronic
1084175174 11:67419106-67419128 TCCCCTCCCCGCAGCAGCCCCGG - Exonic
1086429378 11:86720631-86720653 TCCCTCCACTGATGAAGCTCTGG + Intergenic
1088502543 11:110497160-110497182 TCCCACCACCCTTGAAGCCTAGG - Intergenic
1090541403 11:127710555-127710577 GCCCCCCACCCCTTCAGCCCTGG + Intergenic
1090660599 11:128879286-128879308 TCCACCCACAGCTGATGCCGTGG + Intergenic
1090705592 11:129333441-129333463 TCCCAGCACCTCTGAACCCCAGG - Intergenic
1202816849 11_KI270721v1_random:49947-49969 GCCCCAGACCCCTGAAGCCCGGG - Intergenic
1092262391 12:6959622-6959644 TGCCCCCACCCCGGAAGACCTGG - Intronic
1094036761 12:26080272-26080294 TCCTCCCACCCCTTCAGCCCTGG - Intergenic
1094845876 12:34361165-34361187 TCTCCCCACCGCACATGCCCAGG - Intergenic
1096231431 12:49898912-49898934 CCCCCCACCCCCTGAAGCCCTGG - Intronic
1096252097 12:50040040-50040062 TCCCTCCCCTGCTGAATCCCGGG + Intergenic
1096499494 12:52056272-52056294 CCACCCCACCTCTGAACCCCAGG + Intronic
1097058820 12:56267299-56267321 CCCCTCCACCGCGGAACCCCGGG - Intronic
1097690337 12:62728819-62728841 TCAGCCCTCCGCTGGAGCCCTGG - Intronic
1102349763 12:112183942-112183964 CCCACCCACCGCGGAAGGCCAGG + Intronic
1102785276 12:115599539-115599561 TCCCCCCACCGGTGCTGCCCTGG + Intergenic
1105208333 13:18241921-18241943 TCCCACCCCAGCTGAAGCCATGG + Intergenic
1108733849 13:53261854-53261876 TCCCCACACCACTGAGGCCCAGG - Intergenic
1113416072 13:110129700-110129722 TGCCCCCAGCGCAGCAGCCCGGG + Intergenic
1113489122 13:110677821-110677843 TCACCCCACCAGGGAAGCCCAGG + Intronic
1113679016 13:112229380-112229402 TCCCTCCAAGGCAGAAGCCCAGG - Intergenic
1114615937 14:24068498-24068520 TCCTCTCTCCACTGAAGCCCTGG - Intronic
1121017243 14:90556249-90556271 TCCCCCCTACCCTGAAGCCTGGG + Intronic
1122421075 14:101577797-101577819 TCCCTCCACTGGTGAGGCCCTGG + Intergenic
1122717850 14:103706145-103706167 TCCACCCAGCACTGAAGCTCAGG + Intronic
1122903617 14:104792166-104792188 TCCCCCCACCCCCAAAGCTCAGG + Intronic
1122968666 14:105143696-105143718 TGCCCCCAACACTGAGGCCCTGG + Intronic
1126113292 15:45187768-45187790 CGCCCCCCCCGCGGAAGCCCAGG + Intronic
1131013443 15:89038518-89038540 TGGCCCCACTGCTGCAGCCCTGG + Intergenic
1131971289 15:97895629-97895651 TCCCCCCTCCCCTCAACCCCTGG - Intergenic
1135382789 16:22008266-22008288 TCCCCCCACCCCCCGAGCCCCGG - Exonic
1138154735 16:54692876-54692898 TCCACCCAACACGGAAGCCCCGG + Intergenic
1139678118 16:68539387-68539409 TCCCGCCCCCGCCGAAGCCTCGG - Exonic
1142088843 16:88199423-88199445 TGCTCCCACCCCTGAAGACCAGG - Intergenic
1146716154 17:35088946-35088968 TCCCCCCACCCCTGTAGGGCAGG + Intronic
1146902618 17:36598456-36598478 TCCCTCTACAGCTGAAGCCTGGG + Intronic
1147320710 17:39644226-39644248 TCCCCCTCCCCCTGAATCCCAGG + Intronic
1147767169 17:42844923-42844945 GCCCCCCAAGGCTGCAGCCCTGG + Exonic
1148122968 17:45223110-45223132 TCTCCCCACCCCCGACGCCCTGG + Intronic
1150651972 17:67016338-67016360 GCCCCCCACCGCTGGCCCCCAGG + Intronic
1150840132 17:68600136-68600158 TCCACCCACGGCTCCAGCCCTGG - Intronic
1151786695 17:76278678-76278700 TCCCCCCACCGCTCTAATCCCGG + Intronic
1152197775 17:78927576-78927598 GCCCCCCAACCCTGGAGCCCAGG - Intergenic
1152362616 17:79839571-79839593 TCCCCCCGCCGCCCAGGCCCGGG - Intergenic
1152938442 17:83153678-83153700 TCCCCACACAGCTGTAACCCGGG - Intergenic
1153959015 18:10124494-10124516 TGCCCCCACCCCTAAAGCCAGGG + Intergenic
1157176603 18:45457865-45457887 TCCTCCCACCGCCCCAGCCCCGG - Intronic
1158961291 18:62589740-62589762 TCCTCCCTCCCCTGAATCCCTGG + Intergenic
1160293474 18:77616821-77616843 TCCCCCCGCCGCTGAAATCACGG + Intergenic
1160377429 18:78423590-78423612 TCCTCCCACCTGTGAAGTCCAGG - Intergenic
1160510681 18:79451846-79451868 TCCCACCAGCGCCGAAGCCCAGG - Intronic
1160732517 19:647742-647764 CTCCCCCAGCGCTGAAGCACGGG - Exonic
1160970503 19:1765804-1765826 TCCCCTCACCACTGCAGCCATGG - Intronic
1161030573 19:2056182-2056204 TCCACCCCCAGCTGGAGCCCTGG + Intergenic
1161334974 19:3708216-3708238 TGCCCTCACCGCCGAGGCCCTGG - Intronic
1162968818 19:14168086-14168108 ACCCCCAGCCTCTGAAGCCCTGG + Intronic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163159600 19:15456959-15456981 GCCCCTCACAGCTGAAGCTCAGG + Intronic
1164226564 19:23251232-23251254 TTCCCCCACCTCTGATGTCCAGG - Intergenic
1164526909 19:29019540-29019562 TCCTGCCACCTCTGCAGCCCCGG + Intergenic
1164648125 19:29873690-29873712 TCCCCGCTCCGCAGATGCCCGGG - Intergenic
1164980167 19:32607707-32607729 TCCCCCTCCTGCTGAAGCACGGG - Exonic
1165675585 19:37719721-37719743 CCCACCCACCGCTCGAGCCCCGG + Exonic
1165838675 19:38774071-38774093 TCCCCTCAGCGCTGCACCCCTGG + Intergenic
1166853465 19:45771100-45771122 TCGCCCCACCGCTGAGGGCTGGG - Intronic
1167471402 19:49677973-49677995 TCCCCCAACTCCTAAAGCCCTGG - Intronic
1168633456 19:57975363-57975385 TCCTCCCATCTCTGAAGCCTAGG - Intergenic
925732347 2:6928388-6928410 TGCCCTGACCGCTGAAGGCCAGG - Intronic
926251741 2:11158873-11158895 TCCCCCCATCCCTGCAGCCTGGG - Intronic
932429858 2:71667751-71667773 TCCCCTCACCCCTGTAGGCCTGG + Intronic
932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG + Intergenic
933852944 2:86385561-86385583 TCCCCAAACCCCTGAGGCCCTGG + Intergenic
934993151 2:98935760-98935782 CACCCCCGCCGCCGAAGCCCTGG - Intronic
935712799 2:105913997-105914019 TCCACCCAGTGCTGAAGGCCAGG - Intergenic
935746463 2:106193935-106193957 ACCCCCTACCGCTTAGGCCCGGG - Intronic
938102588 2:128507196-128507218 TCCCTCCACTGCTAAGGCCCTGG - Intergenic
938861763 2:135376671-135376693 TTCCCCCAGGGCTGAACCCCTGG - Intronic
944001425 2:194842960-194842982 GCCCACAACCCCTGAAGCCCCGG - Intergenic
948096927 2:235342989-235343011 TCCCCCCACCACTTAATCTCTGG + Intergenic
1169872506 20:10262915-10262937 TCCCCCCACCGCCCACCCCCAGG - Intronic
1171316053 20:24195645-24195667 TACCCCCACCCCTGAATTCCTGG - Intergenic
1173869223 20:46331272-46331294 TCCCCCGACCTTCGAAGCCCAGG - Intergenic
1174085867 20:48006772-48006794 TCCACCCACCCCTCCAGCCCTGG - Intergenic
1174667097 20:52269237-52269259 TGCCCCCACCTCTTAACCCCTGG - Intergenic
1177209999 21:18059297-18059319 TCCCCAAACCTCTGGAGCCCAGG - Intronic
1180042788 21:45288495-45288517 TGCCCCCAACCCTGGAGCCCCGG + Intergenic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1181524231 22:23470091-23470113 TCCCACCCCAGCTGAAGCCCGGG + Intergenic
1181851977 22:25755921-25755943 TCCCCCCACCCCCGTTGCCCAGG + Intronic
1181878063 22:25955467-25955489 TCCGCACACCCCTGAGGCCCAGG - Intronic
1182350212 22:29695233-29695255 TTCCCCCACCGGTGAGGACCTGG + Exonic
1183789570 22:40055130-40055152 TCGCCCCACCTCTGTAGTCCTGG - Intronic
1184688204 22:46105806-46105828 GCCCCCCACCGCAGAAGGGCTGG + Exonic
1184901904 22:47451568-47451590 CCCACCCACCTCTGAAGGCCAGG + Intergenic
1185173051 22:49304589-49304611 CCCCTCCACCGCTGATGGCCTGG - Intergenic
1185296654 22:50058122-50058144 ACCCCCGACCGCGGAACCCCAGG - Intergenic
950445726 3:13036618-13036640 CCCCCACACCGCTGATGCCCTGG - Intronic
951608960 3:24470048-24470070 TACTCCCAAAGCTGAAGCCCTGG + Intronic
953406510 3:42662581-42662603 GCCCACCACCCCTGAAGCTCAGG + Intronic
953799026 3:46007525-46007547 TCAGTCCACTGCTGAAGCCCAGG - Intergenic
955050097 3:55401913-55401935 TCCCCTCACCCCTCAACCCCTGG - Intergenic
955753191 3:62203349-62203371 TGCCACCACCGCCGAACCCCAGG - Exonic
961431752 3:126888852-126888874 TCTCCCCAGAGCGGAAGCCCAGG - Intronic
961442426 3:126960928-126960950 GCCCCGCACAGCTCAAGCCCAGG + Intergenic
961749513 3:129087118-129087140 TCCCCCCACCCCTGGATCCTGGG - Intergenic
965539029 3:169853918-169853940 TCTCCCCACTGCTCAAGCACAGG - Intronic
967055340 3:185825105-185825127 TCCCCCCACCGCGGCCGGCCCGG + Intergenic
968576446 4:1368520-1368542 TCCCCTCCCCACTGAAGCCCAGG + Intronic
968627894 4:1636272-1636294 ACACCCCTCCGCTCAAGCCCAGG + Intronic
968898557 4:3419562-3419584 TCGCCCCACCGCCAAAGCGCTGG - Intronic
968903323 4:3441025-3441047 TCCTCCCACCTCGGCAGCCCTGG + Intergenic
969476984 4:7427424-7427446 TCCTCCCACTGCTGAAGCTCAGG - Intronic
969639621 4:8389050-8389072 TCCCACCACCACTGCTGCCCCGG + Intronic
969657254 4:8505421-8505443 TCCCAGCACCTCTGCAGCCCGGG + Intergenic
970980538 4:22091502-22091524 TCCACCCACCACCAAAGCCCAGG - Intergenic
975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG + Intronic
975922464 4:79408339-79408361 TCACCCCACCCCTCCAGCCCAGG + Intergenic
985655683 5:1130405-1130427 TCCTCCCACAGCTCAAGCTCTGG - Intergenic
986340425 5:6784473-6784495 TCCCTCCTCCCCTGAGGCCCAGG - Intergenic
990277019 5:54208043-54208065 TTCCCCCACCACTGAGGCCCAGG + Intronic
991591405 5:68255421-68255443 TTACCCCACTGCTGAAGCACAGG - Intronic
991592907 5:68273090-68273112 TCCCCCCACCTTTGGGGCCCAGG + Intronic
992878447 5:81081258-81081280 TCTCCCCTCGGCTGGAGCCCTGG + Intronic
995765462 5:115611921-115611943 TCTCCCCACAGCAGAAGCCCTGG - Intronic
998367727 5:141641527-141641549 TCCCCCGCCGGCTAAAGCCCCGG - Exonic
998914204 5:146996649-146996671 TCCTGCCACTGCTGAAGTCCAGG - Intronic
1002291525 5:178204088-178204110 TCGCCCAACCTCGGAAGCCCGGG + Intergenic
1002430190 5:179198951-179198973 TCCACACACCTCTGAGGCCCAGG - Intronic
1002857892 6:1054718-1054740 TCCACCCACCGCTGAGGGCCAGG + Intergenic
1003092864 6:3118787-3118809 TTCTCTCAGCGCTGAAGCCCGGG + Exonic
1003928173 6:10896816-10896838 ATCCCCCACTGCTGAAGCCTGGG - Intronic
1005447516 6:25940022-25940044 GCCCCCCACTACTGAATCCCAGG + Intergenic
1007482826 6:42161358-42161380 TCCCCTGACCGCTGAAGCCTGGG + Intronic
1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG + Intronic
1008752962 6:54758543-54758565 TCCCCCATCCCCTGAAGCACAGG - Intergenic
1009695379 6:67096255-67096277 ACCCACCACTGCTGATGCCCAGG + Intergenic
1014295578 6:119613309-119613331 TCCTCCCACCCCTGACTCCCTGG + Intergenic
1015773363 6:136791460-136791482 ACCGCCCAGCGCTGGAGCCCTGG - Intronic
1017978983 6:159382050-159382072 CCCCACCACCCCTCAAGCCCAGG + Intergenic
1018499026 6:164382708-164382730 TCCCCCCACCTTTGTCGCCCAGG - Intergenic
1018970541 6:168525808-168525830 TCCAACCACAGCTGCAGCCCAGG - Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1024075090 7:45814035-45814057 TCGCCCCACCGCGGCCGCCCGGG - Intergenic
1024226079 7:47327842-47327864 ACCCCCCTCCACTGGAGCCCAGG + Intronic
1025207530 7:57002209-57002231 TCCCCCCACCGCCCCTGCCCTGG - Intergenic
1025829882 7:65039007-65039029 TCCCCCGATCGCTGCAGCCGAGG + Intergenic
1028980067 7:96958111-96958133 TACCTCCACCACTAAAGCCCTGG - Intergenic
1029659078 7:101946984-101947006 TCCCCTCCCAGCTGAAACCCTGG - Intronic
1036706876 8:11052917-11052939 CACCTGCACCGCTGAAGCCCCGG + Intronic
1037770757 8:21798106-21798128 TCCCCCAAGCAATGAAGCCCAGG + Intronic
1038426627 8:27468211-27468233 CCACCCCAACCCTGAAGCCCAGG + Intronic
1039216015 8:35272371-35272393 TCCCCTCAGAGCTGATGCCCAGG - Intronic
1042146889 8:65739046-65739068 TCCCCAGGCCGCTGGAGCCCTGG - Intronic
1049587447 8:143438622-143438644 TCCCCACAGCGGGGAAGCCCAGG + Intronic
1049860430 8:144894485-144894507 CCCACCCACCGCAGCAGCCCTGG + Intronic
1049879611 8:145052876-145052898 TCCCCTAAGCGCTGAGGCCCAGG + Exonic
1052623363 9:30943563-30943585 CACCCCCACCGCTGCAGCCAAGG - Intergenic
1053239945 9:36487408-36487430 GCCCCCCACCGCCGCCGCCCCGG - Intronic
1053397038 9:37784818-37784840 TCCCCACAGCGCCGAAGGCCCGG + Exonic
1055566178 9:77570397-77570419 TGCCCCCACCACTGCAGCCCAGG + Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057881526 9:98796300-98796322 TGCCCCCGCCGCTGCGGCCCCGG + Exonic
1060666703 9:125436078-125436100 CGCCCCCACCTCTGAGGCCCAGG - Intergenic
1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG + Intronic
1061866285 9:133493302-133493324 TCTCCCCTCCGCAGCAGCCCTGG + Intergenic
1062318318 9:135978714-135978736 TCCCCCCCCCTCAGTAGCCCTGG + Intergenic
1062389052 9:136326920-136326942 GCCCCCCACCTCTGAGACCCTGG - Intergenic
1062442741 9:136578459-136578481 CGCCCCCACCGCTGTGGCCCAGG + Intergenic
1062533076 9:137010266-137010288 TGCCCGCACCGTTGACGCCCAGG + Exonic
1185506305 X:634160-634182 TATCCCCACCGCTGCAGCGCAGG - Intronic
1189331310 X:40146373-40146395 TCCCCCGCCCGCTCAGGCCCCGG - Intronic
1197721674 X:129749227-129749249 TCCCCCCTCCCCTGAGCCCCAGG - Intronic
1200121382 X:153792584-153792606 TGCTGCCACAGCTGAAGCCCAGG - Intronic
1200252051 X:154559006-154559028 TCCCCCCACGGCTCCTGCCCTGG - Intronic
1200265717 X:154645410-154645432 TCCCCCCACGGCTCCTGCCCTGG + Intergenic