ID: 1180612739

View in Genome Browser
Species Human (GRCh38)
Location 22:17108451-17108473
Sequence CTGCTCTTCCAGCAGGTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 308}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180612739_1180612749 11 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612749 22:17108485-17108507 GGCAGGAGTCATGACCTGGGTGG 0: 1
1: 0
2: 3
3: 24
4: 287
1180612739_1180612750 12 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612750 22:17108486-17108508 GCAGGAGTCATGACCTGGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 213
1180612739_1180612745 -6 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612745 22:17108468-17108490 GAGCAGGCCATCTCGGAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 161
1180612739_1180612747 7 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612747 22:17108481-17108503 CGGAGGCAGGAGTCATGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 172
1180612739_1180612748 8 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612748 22:17108482-17108504 GGAGGCAGGAGTCATGACCTGGG 0: 1
1: 0
2: 2
3: 27
4: 296
1180612739_1180612744 -10 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612744 22:17108464-17108486 GGAAGAGCAGGCCATCTCGGAGG 0: 1
1: 0
2: 1
3: 19
4: 137
1180612739_1180612752 26 Left 1180612739 22:17108451-17108473 CCCTGGACCTGCTGGAAGAGCAG 0: 1
1: 1
2: 1
3: 29
4: 308
Right 1180612752 22:17108500-17108522 CTGGGTGGGCCGTCAGAAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180612739 Original CRISPR CTGCTCTTCCAGCAGGTCCA GGG (reversed) Exonic
900298402 1:1964418-1964440 CTTCTCTTCCAGGAGGTGGAGGG - Intronic
900360978 1:2288963-2288985 TCGCTCTTCCTGCAGGTCCCCGG + Intronic
900526212 1:3130081-3130103 CTGCTCCCCCAACAGGTCCTGGG + Intronic
901038602 1:6350793-6350815 CTGCTTCTCTAGCAGCTCCAAGG + Intronic
901234488 1:7660685-7660707 CTCCTCTCCCACCAGCTCCAGGG - Intronic
901916963 1:12507272-12507294 CTGCCCTCCCAGCTGGCCCATGG + Intronic
902334730 1:15748366-15748388 CAGCTCTTCTGGCAGGTCCTGGG + Intergenic
902971917 1:20059969-20059991 CTGCTTTTCCAGCACCCCCAAGG + Intronic
903832286 1:26182526-26182548 CTTCTGTTCCAGCAGCTCCTTGG - Exonic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
904296198 1:29521268-29521290 CTGCTCATCCCCCAGGCCCAAGG - Intergenic
904410134 1:30320178-30320200 CTGCTCATCCCCCAGGCCCAAGG + Intergenic
905417688 1:37815588-37815610 CTGCTCTTCAAGTAGCTGCAGGG + Intronic
905515068 1:38556630-38556652 CTGCTCTTCCAGCATGACCTTGG + Intergenic
906102602 1:43272766-43272788 CTGCTCTGCCAGCATGTCCGGGG - Exonic
906537339 1:46558792-46558814 CTGCTGTTCCTGCAGGGCCAGGG + Exonic
911062668 1:93761480-93761502 CTGTGGTTTCAGCAGGTCCAGGG - Intronic
912958730 1:114176078-114176100 CTTTTCTTCCACCAGGGCCAAGG + Intergenic
913660743 1:121004575-121004597 CTGCTCTTCCACCAGGCTGAAGG - Intergenic
914012106 1:143787731-143787753 CTGCTCTTCCACCAGGCTGAAGG - Intergenic
914165725 1:145173403-145173425 CTGCTCTTCCACCAGGCTGAAGG + Intergenic
914650737 1:149696394-149696416 CTGCTCTTCCACCAGGCTGAAGG - Intergenic
915496339 1:156285243-156285265 CTTCACTTCCAGTAGGGCCAGGG - Exonic
916361154 1:163970718-163970740 TAACTCTTCCAGCAGGTTCAAGG - Intergenic
918146107 1:181757432-181757454 CTGCCCTTACAGCAAGTACATGG - Intronic
919656492 1:200201976-200201998 CTCCTCTGCAAGCAGGTGCATGG - Intergenic
919743247 1:200993029-200993051 CAGCTCTTCCTGCAGCCCCAGGG + Intronic
922919637 1:229291441-229291463 CTGCCCTTCCAGGAGGACCAGGG + Intronic
922932625 1:229402335-229402357 CTGTTCTTCCAGGAGCACCATGG + Intergenic
1062944918 10:1452998-1453020 CTGCATTTCCAGCACGTCCCAGG + Intronic
1063272136 10:4522229-4522251 CTGCTCTTCCATCAGAAGCAAGG + Intergenic
1063383383 10:5600863-5600885 ATTCACTTCCAGCAGGGCCAAGG - Intergenic
1063560553 10:7122358-7122380 CTGCTCTTCCAGCTGGCTCCTGG - Intergenic
1063845654 10:10124355-10124377 CTGCATATCCAGCAGGTCTAGGG + Intergenic
1063943855 10:11158238-11158260 CTGCTTCTACAGCAGGTCTAGGG - Intronic
1064003316 10:11681399-11681421 CTGGTATTCCAGCAGCTTCAGGG + Intergenic
1065403896 10:25340762-25340784 CTGCTCTTCCTGTAGGACCTCGG - Intronic
1066156484 10:32683868-32683890 CTGCTTTTCATGCAGGTCCCAGG - Intronic
1067539057 10:47138400-47138422 CTCCTCTTCCAGAAGGGCCAAGG - Intergenic
1067672150 10:48333362-48333384 CTCCTCTACCAGCAGGTCTGTGG + Intronic
1068120669 10:52779661-52779683 CTTCTCTTCCAGAAGGGCCAAGG + Intergenic
1069797350 10:71061869-71061891 CTGCTCTTTCTGCAGCTCCGGGG + Intergenic
1070163330 10:73879475-73879497 CTTCTCATCCATCAAGTCCAGGG + Intergenic
1072002831 10:91214383-91214405 CTGCTGCTCCAGCAGTCCCATGG - Intronic
1072554379 10:96503662-96503684 CCCCTCTTCCAGAAGGCCCAGGG - Intronic
1074776318 10:116770654-116770676 CTGCTCTTCATAAAGGTCCATGG + Intergenic
1075261628 10:120968227-120968249 CAGCTCTTAGAGCAGTTCCATGG + Intergenic
1075414747 10:122254112-122254134 CTGCTGTTCCTCCAGTTCCATGG + Exonic
1075444575 10:122504609-122504631 CTGGTCTTCCAGCCAGTCCAGGG + Intronic
1075972724 10:126668355-126668377 CTTCTCTTCTATCAGCTCCAAGG - Intronic
1076583408 10:131530094-131530116 CTGCCCTTCGAGCAGGTCCCAGG - Intergenic
1076668862 10:132108215-132108237 CTTCTGCTCCAGCAGGACCAAGG - Intronic
1076695129 10:132243736-132243758 CTGCTCTACCACCAGGGCCATGG - Intronic
1076890116 10:133279224-133279246 CTGCTGCTCCAACTGGTCCAGGG - Exonic
1077916635 11:6615841-6615863 CTCTTCTTCCTGCAGGTCCCAGG - Intronic
1078619359 11:12893259-12893281 CTGGTCTTCCAGCAGGACGTAGG + Intronic
1083103379 11:60333749-60333771 CTCTTGTTCCTGCAGGTCCATGG - Intergenic
1083160296 11:60850273-60850295 CTGCTTCTGCAGCAGGGCCAGGG - Exonic
1083679133 11:64343213-64343235 CTGCTCTTCCAGCAGCGCCTTGG - Exonic
1083956810 11:65988383-65988405 CTGCCCATCTACCAGGTCCAAGG + Intergenic
1084324193 11:68389994-68390016 CTTCCCCTCCTGCAGGTCCAGGG - Exonic
1084465381 11:69320269-69320291 CAGGTCTTCCAGCAGGTCTGGGG - Intronic
1084662049 11:70551775-70551797 CTGCTCGTCCACCTGGTCCCTGG + Intronic
1085046993 11:73359473-73359495 CTGCTCTGTCAGCACGCCCACGG + Intronic
1087891500 11:103542517-103542539 CTGCCCTTCCAGCAGGGCTGCGG - Intergenic
1089259884 11:117217011-117217033 CTGCCCTTCCAACAGGTAAAGGG + Intronic
1089362122 11:117897935-117897957 CTCCTGTCCCAGAAGGTCCAGGG + Intergenic
1089461504 11:118656827-118656849 GTGCTCTGCCAGGAGGCCCACGG - Exonic
1090830021 11:130414744-130414766 CTGCTGGTCCAGCTGGTACAGGG + Exonic
1096916045 12:55034631-55034653 CTTCTCTCCAAGCAGCTCCAAGG + Intergenic
1097604665 12:61738589-61738611 CTGCTCTTGCAGCATATCCTGGG + Intronic
1098176959 12:67802883-67802905 CTGCTCTTCCTGCCGTACCATGG - Intergenic
1100503922 12:95201228-95201250 CTGATCTTCCAGGTGGTTCAGGG - Intronic
1101718976 12:107334763-107334785 CTCCTCTTCCATCTGGCCCAAGG - Intronic
1102463725 12:113115750-113115772 CAGCTCTTCCAGCAAAGCCAAGG + Exonic
1102979708 12:117231781-117231803 CTGGTCTTCCACCAGTTCTAAGG - Intronic
1103273782 12:119695042-119695064 CTGCTTTTCCAGCAAGTTCCTGG + Intronic
1103273945 12:119696315-119696337 CTGCTTTTCCAGCAAGTTCCTGG - Intronic
1104013937 12:124950149-124950171 CTGCCCTTCCAGCAGGAACCGGG + Exonic
1105247629 13:18667068-18667090 CTTCTCTTCCAGCAGCTCGTAGG - Intergenic
1105475617 13:20725975-20725997 CATCTCTTCCAGCAGGGCAAAGG + Intergenic
1107012557 13:35682915-35682937 CTGCTCATTTAGCACGTCCAAGG - Intergenic
1107043876 13:35975498-35975520 ATCCTCTTCCACCAGCTCCAAGG + Intronic
1108278726 13:48839730-48839752 CTCCTCTTCCAGGAGGTCTGGGG - Intergenic
1112655719 13:101450851-101450873 CTGATGTTGCTGCAGGTCCATGG + Intergenic
1113365163 13:109669078-109669100 CTGCTGTTCCCGGAGGTCCAAGG + Intergenic
1113736219 13:112680512-112680534 CATCTCTTCCTTCAGGTCCAGGG - Intronic
1113777877 13:112958967-112958989 CTGCTTTTCCTGCAGGACCCCGG - Intronic
1113885072 13:113654614-113654636 CTGCTCTTAAAGCCGGTTCAGGG + Intronic
1113888314 13:113723104-113723126 CTGTCCGTCCAGCAGCTCCACGG - Exonic
1113981773 13:114282052-114282074 CTGCTCCTCCAGCTGCTCCTTGG - Exonic
1115433168 14:33344802-33344824 CTGGTCTTACAGCAGTTCCAGGG - Intronic
1116688402 14:48073051-48073073 CTGCTCTTCCATCTTGTCCTAGG - Intergenic
1116955153 14:50915876-50915898 CAGCTTCTCCACCAGGTCCACGG + Exonic
1117731567 14:58727596-58727618 CTCCTCTTCCAGCTGTTCCTGGG - Intergenic
1118098498 14:62567537-62567559 CTGCTCTTCCAGCAGGTGCATGG - Intergenic
1119848256 14:77846859-77846881 CTGCCCATGCAGCAGCTCCATGG - Intronic
1121355008 14:93207017-93207039 GTACTCTCCCAGCAGCTCCATGG + Exonic
1122150301 14:99721999-99722021 CTCCTCTTCCAGCAGGCGAAAGG - Exonic
1122834052 14:104422452-104422474 CTTCGCTTCCAGGAGGGCCAGGG + Intergenic
1122840715 14:104461499-104461521 CGGCTCTTCCCGCAGCTCCCAGG - Intergenic
1122925585 14:104898025-104898047 CTGACTTTCCAGCAGGTCCTGGG - Intergenic
1123078771 14:105681944-105681966 CTCCACTTCCAGCCGGTCCTGGG + Intergenic
1123671743 15:22665227-22665249 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1123774648 15:23566346-23566368 CTGCTCCTCCAGCAGCTCCACGG - Exonic
1124323785 15:28738453-28738475 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124527677 15:30471694-30471716 CTGCTCTGCCAGCATCTTCAGGG - Intergenic
1124770982 15:32536008-32536030 CTGCTCTGCCAGCATCTTCAGGG + Intergenic
1125396641 15:39255820-39255842 CTGCTATTCCAACAGGATCAGGG + Intergenic
1125585101 15:40814232-40814254 CTGCCCTTCCGGGAGGACCAGGG - Exonic
1126201502 15:45991970-45991992 CTCCTCTGCAAGCAGGTCGATGG + Intergenic
1128106617 15:65050054-65050076 CATCTCTTCCAGCAGCTCCTGGG - Exonic
1129392863 15:75229247-75229269 CTGCCTTTCCAGCAGGACAAAGG + Intergenic
1129770453 15:78200408-78200430 CTCCTCTTCCAGCTGGTCTAGGG - Intronic
1129801479 15:78418240-78418262 CAGCTCTTCCGGCAGACCCATGG - Intergenic
1130317787 15:82810602-82810624 CTGCTCTGCCAGCATCTTCAGGG - Intronic
1130349949 15:83082831-83082853 ACCCTCTCCCAGCAGGTCCATGG - Intergenic
1130688634 15:86060980-86061002 CAGGTCATCCAGCTGGTCCATGG - Intergenic
1131116540 15:89799612-89799634 CTGCTCTTGCAAGAGGTCCAGGG - Intronic
1131138517 15:89958234-89958256 CTGTTGTTCCAGCAGCTCCCAGG + Intergenic
1131159969 15:90099299-90099321 CTGCTCTTCCATCATGCCCTTGG + Intronic
1132173656 15:99689800-99689822 AATCTCTTTCAGCAGGTCCAAGG + Intronic
1132245437 15:100292853-100292875 ATTCTCTTCCAGCAGGACGAAGG + Intronic
1132883843 16:2173774-2173796 CAGCTCGTCCTGCAGGGCCAAGG - Exonic
1132892126 16:2209644-2209666 CTGCACTGCCAGCAGCTCCTGGG + Exonic
1133237255 16:4393035-4393057 CTCCTCTTCCAGCAGGGCTGGGG - Intronic
1134291662 16:12906505-12906527 CTGCTCTTGCAGCTGCTCAATGG - Intronic
1136024972 16:27463300-27463322 CTGCGCTTCCAGAATGCCCAGGG - Intronic
1136386155 16:29927214-29927236 CAGCCCTGCCAGCAGGTCCCTGG + Intergenic
1136567136 16:31077241-31077263 CTGGTGTTCCAGCAGCTCCCGGG - Exonic
1139582252 16:67880582-67880604 CTCCACTTCCTGCAGCTCCAGGG - Exonic
1140959407 16:79897656-79897678 CTGGTCTTCCAGCAGGGCTCTGG - Intergenic
1141098177 16:81177768-81177790 CTGCTCTTCCCTCAGCTCCTGGG - Intergenic
1141449662 16:84089739-84089761 CAGCTCTTCCAGCATGGACATGG - Intronic
1141622696 16:85245403-85245425 CTGCGTTTCCACCTGGTCCAGGG + Intergenic
1142172925 16:88632233-88632255 CTTCCCCTCCAGCAGCTCCACGG - Intergenic
1142896541 17:2982814-2982836 CTGCTCTTCCATTATGACCAAGG - Intronic
1143498100 17:7323904-7323926 CTGCGCTTCCATCAGCTGCACGG - Exonic
1144613488 17:16746707-16746729 CTGCTCCTCCAGCTGCTCCTTGG + Intronic
1145038397 17:19557586-19557608 CTGCCCTCCCAGCTGGCCCATGG + Intronic
1145133159 17:20376783-20376805 CTGCTCCTCCAGCTGCTCCTTGG + Intergenic
1145994931 17:29099721-29099743 CTGCTCCTCCAGCCGTGCCAAGG + Exonic
1146224073 17:31050797-31050819 CTGCTCCCCCAGCAGCCCCAGGG - Intergenic
1146477775 17:33176888-33176910 AGGCTCTTCCAGAAGGTACAGGG + Intronic
1147158795 17:38559075-38559097 CCGCTCCTCAAGCAGGCCCAGGG - Intronic
1147553473 17:41461579-41461601 CTGATCTTCCAATAGTTCCAGGG - Intronic
1148502992 17:48106170-48106192 CTGCGGTCCCAGCAGCTCCAAGG + Intronic
1148817306 17:50338419-50338441 TTTCTCTTCCAGCAGTACCAGGG - Intergenic
1149714527 17:58775476-58775498 CAGATCTTCCAGCAGTTACATGG + Intronic
1153847831 18:9065717-9065739 TTTCTCTTCCTCCAGGTCCAGGG + Intergenic
1155089010 18:22488252-22488274 CTGTTCTTCCCACAGGTCTAAGG - Intergenic
1155888567 18:31238425-31238447 CTACTCTTTCAGCAGGCTCATGG - Intergenic
1156050216 18:32923711-32923733 CTGATTTTCCAGCGGGTCAACGG - Intergenic
1159123880 18:64200824-64200846 GTGCTCTTCCTGCAGGTCAAGGG + Intergenic
1159901657 18:74052923-74052945 CTGAATTTCCAGCAGGTCCCTGG - Intergenic
1159922140 18:74236291-74236313 CAGCTCAGCCAGCATGTCCAAGG + Intergenic
1160680972 19:411478-411500 GTGCTCTTTCAGCAGGCCCGAGG + Intergenic
1161353950 19:3808960-3808982 CTTCTCCACCAGCAGCTCCATGG + Exonic
1161531945 19:4794981-4795003 CTGTTCTTTCAGCTGCTCCAAGG + Exonic
1163141857 19:15355110-15355132 CTGCTCTTCCAGCAGCTGTTCGG + Exonic
1163187538 19:15649565-15649587 ATCCTCTTCCAACTGGTCCATGG - Intronic
1164463206 19:28465652-28465674 CAGCTCTGCCAGCAGGGCCAGGG - Intergenic
1165477402 19:36039374-36039396 CTGCTGTGCCAGCCGTTCCAGGG + Exonic
1165696011 19:37901509-37901531 CTACTCTCTCAGCAGCTCCAGGG - Intronic
1166204402 19:41259718-41259740 CAGCTCCTCCTGCAGCTCCAGGG - Exonic
1166781726 19:45346692-45346714 CTCCTCCTCCAGCTGGGCCACGG - Exonic
926090773 2:10047829-10047851 CAGCTCTCCCTGCAGGGCCAAGG + Exonic
927148027 2:20179726-20179748 AAGCTCTGCCAGCAGGCCCAGGG - Intergenic
927151733 2:20200144-20200166 CTGCTCCATCAGCAGGTGCAGGG + Intergenic
927679648 2:25131383-25131405 CTGGTCATCCAGCAGCTCCTGGG + Exonic
929437875 2:41941977-41941999 CTGGTGATTCAGCAGGTCCATGG - Intronic
932331305 2:70899989-70900011 TTGCTCTTCCAGGAGGGCCGGGG + Intergenic
932615446 2:73228449-73228471 CTCTTCTACCAGAAGGTCCAGGG + Exonic
935605588 2:104969616-104969638 CTGATCACCCAGCAGGTCCGAGG - Intergenic
936227921 2:110674751-110674773 CTGCCCTTCCAGCAGGATCCAGG + Intronic
936457885 2:112689138-112689160 CTACTCTCCCTGCAGGTCCTGGG - Intergenic
937122230 2:119448850-119448872 CTTCTCTGCCCTCAGGTCCAGGG - Intronic
937829929 2:126408516-126408538 CAGATCTGCCAGCAGTTCCAAGG - Intergenic
940208348 2:151229638-151229660 GAGCTCTTTCAGTAGGTCCATGG - Intergenic
940633703 2:156270995-156271017 CTGCTCTACCACCTGGTCCCAGG + Intergenic
941670125 2:168284046-168284068 GTTCTCTTCCAGCAGCTGCAGGG - Intergenic
942221188 2:173770552-173770574 CTCCTCTTCCAGGAGGTCAAAGG + Intergenic
942224887 2:173806415-173806437 CTGCTGATCCTGCCGGTCCATGG - Intergenic
943076704 2:183204567-183204589 CAGCTGTTCCAGAAGGTCCTGGG + Intergenic
945447882 2:209959674-209959696 CTTCACATCCAGCAGTTCCAAGG - Exonic
948113257 2:235473916-235473938 CTGCACTTCCATCAGGTTCCAGG - Intergenic
1168974078 20:1951117-1951139 CTGCTGGTCCAGCCGATCCATGG + Intergenic
1168998343 20:2148813-2148835 CTGCCCTTCCAGGGGGTCCGGGG + Intronic
1169105189 20:2988401-2988423 TTCCTCTTCCAGCTTGTCCACGG - Exonic
1169427761 20:5509868-5509890 CTGCTGTTCCTGCAGGTCAGTGG - Intergenic
1172029195 20:31969369-31969391 CTCCCCTTCCAACAGGGCCAAGG + Intronic
1173250652 20:41362660-41362682 GTACTCCTCCAGCAGGGCCAGGG + Exonic
1173726928 20:45304790-45304812 CTGATCTCCCCGCAGGTCCCAGG - Exonic
1174552528 20:51372383-51372405 CCACTCTTGCAGCAGGTCCCGGG + Intergenic
1174588094 20:51624268-51624290 CTGTCCTTTCAGCAGGGCCATGG - Intronic
1175765086 20:61586985-61587007 CTGCTCTCCCAGCAGCCCCTGGG + Intronic
1176454845 21:6899124-6899146 CTTCTCTTCCAGCAGCTCGTAGG - Intergenic
1176679140 21:9809798-9809820 CAGCTCTTCCAGAAGATCAAGGG + Intergenic
1176833018 21:13764172-13764194 CTTCTCTTCCAGCAGCTCGTAGG - Intergenic
1179080552 21:38166702-38166724 CTCCTCCTCCTGCAGGTGCAGGG - Intronic
1180080831 21:45486920-45486942 CTGGTGGTCCAGCAGGTCCGGGG - Exonic
1180156396 21:45979433-45979455 CGGCTCCGCCAGCAGGTCCGCGG - Intergenic
1180612739 22:17108451-17108473 CTGCTCTTCCAGCAGGTCCAGGG - Exonic
1180744534 22:18078477-18078499 CGCCTCCTCCAGAAGGTCCACGG - Exonic
1181802575 22:25357291-25357313 CTTCCCTTCCTGCAGGTCCAGGG + Exonic
1182654105 22:31876152-31876174 CTGCTCTTCCAGCATTTTCTAGG - Exonic
1183011933 22:34953874-34953896 TTGCTCTTCCAACAGTGCCAAGG + Intergenic
1183492011 22:38121820-38121842 CTGGTCTTCCACAGGGTCCAAGG - Intronic
1184040305 22:41939189-41939211 CTGCTCTCCCCGCAGGTGGAAGG - Exonic
1184413037 22:44336881-44336903 CTGCTTTTCCAGGAGGCCGAGGG + Intergenic
1184831728 22:46993041-46993063 GTGCTCTTCCACCTGGACCAGGG - Intronic
1185163173 22:49241729-49241751 CTCCTCATCCAGCCGGGCCAGGG + Intergenic
1185226894 22:49658318-49658340 CTGCTCCTCCTCCAGGTACAGGG + Intergenic
1185368466 22:50447610-50447632 CTGCATTTCCAGCAGAACCAGGG + Intronic
1185377169 22:50487935-50487957 CAGCCCATCCAGCAGGTCCACGG - Exonic
950429280 3:12941571-12941593 CTGCTTGTCCTGCAGGTCCGAGG + Exonic
950461406 3:13124443-13124465 CTGCTCTGCAAGGCGGTCCATGG + Intergenic
951803498 3:26622865-26622887 CTGCTCTTCCTGCAAGGCTACGG + Exonic
951945947 3:28136287-28136309 CTGATGTTCAAGGAGGTCCATGG - Intergenic
952883206 3:37998146-37998168 CTCCTCCTGCAGCAGGTCCTGGG - Exonic
953552841 3:43917768-43917790 TTGCTCTTCCAGCCCTTCCAGGG + Intergenic
953666799 3:44931307-44931329 GGGCTCTTCCACCAGCTCCAGGG - Intronic
953891281 3:46753460-46753482 CTGCTCTGCCAGGTGGGCCACGG - Intronic
955733601 3:62013569-62013591 CTGCTCTTGCAGCAGGGCTTGGG + Intronic
957840042 3:85655871-85655893 ATGCTGTTGCAGCTGGTCCAAGG + Intronic
958526748 3:95270248-95270270 CAGGTCTTCAAGCAGGACCATGG + Intergenic
959825921 3:110795561-110795583 CTGCTGATGCTGCAGGTCCAGGG + Intergenic
961677073 3:128574187-128574209 CTGCTCACCCAGGAGCTCCATGG + Exonic
961724231 3:128915486-128915508 CTCCTCTTCCTTCAAGTCCAGGG + Exonic
962735457 3:138321598-138321620 ATGCTCTTTCAGCTGCTCCAGGG + Intronic
963768789 3:149367359-149367381 CTGCTCTGCCACCAGGGCCCAGG - Intergenic
963811130 3:149777510-149777532 CTCCTGTTCCAGAAGGTGCATGG + Intronic
966234515 3:177686166-177686188 ATGCGCTTCCACCAGGCCCAAGG + Intergenic
966349699 3:179018955-179018977 CTGCTCTACCAGAAGGTAGAGGG - Exonic
967037179 3:185656642-185656664 CTGGTCTTGGAGCAGGACCAGGG + Intronic
967258055 3:187613405-187613427 GTGCTCTTGGAGAAGGTCCATGG - Intergenic
968232461 3:197011857-197011879 CTCCTCTTCCTGCAGGCCCCAGG + Intronic
968491774 4:894002-894024 CTGCTCTCCCCGCAGGCCCTGGG - Exonic
970152767 4:13107112-13107134 CTGGGCTTCCAGGTGGTCCAAGG + Intergenic
972296386 4:37743353-37743375 CTGGTCTTCTTGCAGCTCCAGGG - Intergenic
975182198 4:71359063-71359085 CTACTCTGCCTGCAGTTCCATGG - Intronic
980522476 4:133951489-133951511 CTCCTCTACCAGCAGGGCCTTGG + Intergenic
981041814 4:140230164-140230186 CTCCTCCACCAGCAGGTCCATGG + Intergenic
983946082 4:173586841-173586863 CTGCTTTCACAGCAGGGCCAGGG + Intergenic
985450038 4:190056848-190056870 GGGCTCTGCCAGCAGGTCAAGGG + Intergenic
987090066 5:14502564-14502586 CTGTTCTTCTTGCAGGTCCAGGG + Exonic
987457225 5:18162734-18162756 CTGCTCTTCCATCCTCTCCATGG + Intergenic
990818936 5:59815738-59815760 CCACTTTTCCAGCAGGTCCTTGG - Intronic
990954800 5:61331539-61331561 CTTCCCCTCCAGCCGGTCCAGGG - Intergenic
992995270 5:82326405-82326427 CTGCTCTTTGGGAAGGTCCAGGG + Intronic
999300972 5:150490170-150490192 CTGCCCTTCCTGCACGTCCTGGG + Intronic
999309915 5:150545297-150545319 CTGGGCTTCCTGCAGGTACATGG + Exonic
1000400733 5:160824339-160824361 TTGTTGTTCCAGCAGGTACATGG + Intronic
1001820610 5:174707278-174707300 CGTCTGTTCCAGCAGGGCCACGG + Intergenic
1002092331 5:176812767-176812789 CAGCTCCTCCCGCAGGCCCAGGG - Intronic
1002329658 5:178432806-178432828 CTGCTCTTCCTTGAGGTCCTGGG + Intronic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1003345898 6:5266334-5266356 CAGCTCTTCCATCAGGTCATGGG - Intronic
1006470640 6:34226876-34226898 CTGCTCTTCCAGGGAGTCCCGGG + Intergenic
1011212146 6:84966682-84966704 CTGCCCCACCAGCTGGTCCAGGG - Intergenic
1011962248 6:93105269-93105291 TTGCTCTGCCAGCAAGTTCAGGG - Intergenic
1012230042 6:96750532-96750554 CTCCTCTTCCTGCAGGTTTATGG + Intergenic
1017780835 6:157714022-157714044 CTGCTCTGCCAGGAGGGGCAGGG + Intronic
1017935340 6:159000077-159000099 CTGCTCTTCCAGGGTGTCCTCGG + Exonic
1018154822 6:160976039-160976061 CGTCTCTCCCAGCAGGTCCTTGG - Intergenic
1018541266 6:164882336-164882358 CTTCTATTCCAGCAGGCCCTTGG - Intergenic
1018698445 6:166408430-166408452 CTGCTCTCCCAGCAGGGTGAAGG - Intergenic
1018975044 6:168558197-168558219 CGGCTCTGCCTGCAGGTTCAGGG - Intronic
1019593235 7:1846190-1846212 CTGCCCTTCCCGCAGGGCCAGGG + Intronic
1019696592 7:2449781-2449803 CTGCACTTCCAGCTGGTCATTGG - Intergenic
1023048385 7:36230659-36230681 GTGCCCTTCCAGCAGGCACATGG + Intronic
1023196389 7:37644127-37644149 CTCCTCTTCTCCCAGGTCCATGG + Intergenic
1024434841 7:49339697-49339719 TTGCTCTTCCAGTTGCTCCAGGG - Intergenic
1026870163 7:73846186-73846208 CAGCACTTCCAGCCGGTTCAGGG + Intergenic
1028322428 7:89476870-89476892 CAGTTGGTCCAGCAGGTCCATGG + Intergenic
1028754822 7:94422980-94423002 CTTCTTTCCCAGCAGGACCAGGG - Exonic
1030437257 7:109538743-109538765 CTATTCTTCCCACAGGTCCAGGG + Intergenic
1031104160 7:117518976-117518998 CTGCTATTTCAGCAAATCCAGGG + Intronic
1031119373 7:117703846-117703868 CTTCGGTTCCAGCAGGTCCTTGG + Intronic
1031150158 7:118044923-118044945 CTGCTCTTGCTGCTGGTTCAGGG + Intergenic
1032970510 7:137157854-137157876 CTTCTCTTCCAGCAGTGGCATGG - Intergenic
1034460235 7:151194046-151194068 GGGCTCTTTCAGCAGGTCAAGGG + Intronic
1034725563 7:153332175-153332197 CTTCTCTTCCCTCAGCTCCAGGG + Intergenic
1034989151 7:155536647-155536669 CTGTTCATCCAGCAGGTGGATGG - Intergenic
1035014313 7:155751540-155751562 CTGCTCTTTCAAAAGGTCAAGGG - Intronic
1035325284 7:158062004-158062026 TTGCTCTGACAGCAGGACCATGG - Intronic
1035396580 7:158538937-158538959 CCTCACTTCCAGCAGGTCCTGGG - Intronic
1041080170 8:54208234-54208256 CTGCCTCTCCAGCAGGGCCAGGG - Intergenic
1041409320 8:57536034-57536056 CAGCTATCCCAGCAGGGCCAGGG - Intergenic
1043976927 8:86594337-86594359 CAGCCCATGCAGCAGGTCCACGG + Intronic
1047561273 8:125990262-125990284 CTCCTCTACCAGCAGGGCCGTGG - Intergenic
1049410541 8:142471993-142472015 CTGCTCTGCCACCAGGTCCCAGG - Intronic
1049569279 8:143360857-143360879 CTGCACTTCCAGCAAGCCCCGGG + Intergenic
1049639396 8:143707819-143707841 CTGCTCGTCCAGCCGGACGATGG + Exonic
1049668260 8:143858452-143858474 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049668676 8:143860051-143860073 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049669091 8:143861653-143861675 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049669506 8:143863255-143863277 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049669916 8:143864848-143864870 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049670333 8:143866456-143866478 CTGCGCCTCCAGCAGCACCAGGG + Exonic
1049671132 8:143870353-143870375 CTGGGCCTCCAGCAGGGCCAGGG + Exonic
1049681520 8:143920638-143920660 CTGGGCTTCCAACAGGGCCACGG + Exonic
1049807481 8:144547526-144547548 CTGCTCCACAAGCAGGTCCCCGG + Exonic
1049849165 8:144821552-144821574 CGGCTCATCCGGCAGCTCCAGGG + Intergenic
1049853778 8:144849115-144849137 CTGCTGTTCCTGCAGGGCCAGGG + Intronic
1049920520 9:359040-359062 GTTCTCATCTAGCAGGTCCATGG + Intronic
1050025603 9:1331594-1331616 CTGCTTTTGAAGCAGCTCCAAGG + Intergenic
1051547563 9:18293489-18293511 CTGTGCTACCAGCAGGCCCACGG - Intergenic
1051827290 9:21234287-21234309 CTGCTCCTTCATCAGTTCCAAGG - Intronic
1052977696 9:34423649-34423671 CTGCTCTGGGAGCAGGTCCAAGG + Intronic
1053107446 9:35423795-35423817 CTGCCCTTTCTGCAGGGCCATGG + Intergenic
1054811987 9:69442320-69442342 CAGCTCTTATAGCAGGGCCAGGG - Intronic
1056622160 9:88223560-88223582 CTGCTCTTCCACCAGGCCCCTGG - Intergenic
1057397430 9:94692499-94692521 CTGCTCTTCCTCCAGGACCAAGG - Intergenic
1057897697 9:98922965-98922987 CTGCTCCTGCTGCTGGTCCAGGG + Intergenic
1058420847 9:104831747-104831769 CCTCTCATCCAGCAGCTCCATGG + Exonic
1058822034 9:108741314-108741336 CTCCTCTTCCAGCAACCCCAGGG - Intergenic
1059989828 9:119854413-119854435 ATGCTCATCCTGCTGGTCCAGGG + Intergenic
1060839360 9:126781844-126781866 CTGCCCTTCCAGCAGGGGCGAGG - Intergenic
1061093962 9:128443652-128443674 CTCCTCTAGCAGGAGGTCCATGG - Intergenic
1061364594 9:130165318-130165340 TTGCTCTTCCAGGAAGTCCATGG - Intergenic
1062129133 9:134883315-134883337 CTGCCTTCCCAGGAGGTCCAGGG - Exonic
1062199105 9:135291711-135291733 CTCCTCTACCAGCAGGGCCATGG - Intergenic
1203664310 Un_KI270754v1:12334-12356 CAGCTCTTCCAGAAGATCAAGGG + Intergenic
1187356677 X:18580323-18580345 CTGGTCTACCTGCAGGACCAAGG - Intronic
1187724826 X:22191551-22191573 ATGCTATTACTGCAGGTCCAAGG - Intronic
1188064554 X:25642540-25642562 GTTCTCTTCTAGCAGGTTCATGG + Intergenic
1190151923 X:47956405-47956427 CTGCCCCTCCAAAAGGTCCATGG - Intronic
1190968186 X:55323073-55323095 CTGGCCTTCCAGCAGACCCAGGG - Intergenic
1191036319 X:56029402-56029424 CTTCTATCCAAGCAGGTCCACGG + Intergenic
1192262387 X:69513271-69513293 CAGCTCTACCAGCATGTGCAAGG - Intronic
1194445793 X:93986255-93986277 CTGCTCTTCCTTCCTGTCCATGG - Intergenic
1194675226 X:96785978-96786000 CTGCTCTTCCATTTGCTCCAGGG - Intronic
1198834238 X:140784454-140784476 CAGGTCTTCCAGCATCTCCAGGG + Exonic
1199219913 X:145306090-145306112 CTTCTCTGCCAGCTGGTTCAGGG + Intergenic
1200225280 X:154413573-154413595 CTGCTCCTCCAGCGAGTGCAGGG + Intronic
1200825776 Y:7639018-7639040 CTGGTCTTACAGAAGATCCAGGG + Intergenic
1202234279 Y:22692064-22692086 CTGGTCTTACAGAAGATCCAGGG - Intergenic
1202308880 Y:23504102-23504124 CTGGTCTTACAGAAGATCCAGGG + Intergenic
1202561921 Y:26166486-26166508 CTGGTCTTACAGAAGATCCAGGG - Intergenic