ID: 1180613248

View in Genome Browser
Species Human (GRCh38)
Location 22:17111010-17111032
Sequence TGAGCTTGTCAGGGAGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180613238_1180613248 24 Left 1180613238 22:17110963-17110985 CCCAGCAAGGAAGCAGTTTGTGG 0: 2
1: 0
2: 0
3: 15
4: 186
Right 1180613248 22:17111010-17111032 TGAGCTTGTCAGGGAGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 259
1180613240_1180613248 23 Left 1180613240 22:17110964-17110986 CCAGCAAGGAAGCAGTTTGTGGG 0: 1
1: 0
2: 1
3: 21
4: 122
Right 1180613248 22:17111010-17111032 TGAGCTTGTCAGGGAGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180613248 Original CRISPR TGAGCTTGTCAGGGAGCTGC TGG Exonic
900271959 1:1795211-1795233 GGAGCATGACAGTGAGCTGCGGG - Intronic
900402988 1:2480249-2480271 TGAGCTTGTGCAGCAGCTGCAGG - Exonic
901769314 1:11522498-11522520 AGATGTTGTCAGGGAGCTTCGGG - Intronic
901802160 1:11714606-11714628 GCAGCCTGTCAGGGAGCTGGTGG - Intronic
901856646 1:12048739-12048761 TGAACTTGGCAGGGAGAAGCAGG - Intergenic
902295272 1:15462891-15462913 TGAGGTTGTCAGGGAACAGATGG + Intronic
902298120 1:15482423-15482445 TGAGGTTGTCAGGGAACAGATGG + Intronic
902727499 1:18346923-18346945 GGACCTGGTCAGGGAGCTGGAGG + Intronic
904309622 1:29620394-29620416 TCTCCTTGTCATGGAGCTGCTGG - Intergenic
905340886 1:37276545-37276567 TGAGTTACTCAGGGAGGTGCAGG + Intergenic
905434433 1:37946962-37946984 TGACAATGTCAGGGAGCTGTGGG - Intronic
906547437 1:46630006-46630028 TGAGGTTGGCAGGAACCTGCTGG - Intergenic
912607443 1:111006354-111006376 TGAACTTGCCAGGGAACTCCAGG + Intergenic
916053434 1:161051672-161051694 TGGGCTTGGCCGGGGGCTGCTGG + Exonic
919298466 1:195732374-195732396 AGATCTTATCAGGAAGCTGCTGG - Intergenic
919882656 1:201911068-201911090 TGTGCTTTGCAGGGAGCTCCTGG - Intronic
921561909 1:216669229-216669251 TGAGGTTGTCAAAGAGCTACTGG - Intronic
1062975857 10:1682250-1682272 TGAGCTTGTGGATGAGCTGCTGG - Intronic
1063164788 10:3451516-3451538 GGAGCTTTACAGGGAGGTGCAGG - Intergenic
1063387739 10:5626635-5626657 TGTGCTGGGCATGGAGCTGCTGG + Intergenic
1063564985 10:7164646-7164668 AGACCTTGGCAGGGAGCTGAGGG - Intronic
1063590888 10:7394515-7394537 TGAGCGTGTCGGGGAGTTGTTGG - Intronic
1063900528 10:10727911-10727933 TAAGCCTGGCACGGAGCTGCTGG + Intergenic
1065305741 10:24366804-24366826 TGAGGTTGTCCCAGAGCTGCAGG - Intronic
1069794379 10:71042884-71042906 GGAGCTGGCCAGGGAGCAGCTGG - Intergenic
1070694639 10:78552799-78552821 TGAGCTTGGCAGGACGCTGAAGG - Intergenic
1072119678 10:92395424-92395446 CCAGCTTGGCAGGGAGCTGATGG - Intergenic
1072251446 10:93585408-93585430 GGAGCTTGTCAGAGCACTGCTGG - Intronic
1073878341 10:107950843-107950865 TGTGCTTGTCAGGGAGGCTCAGG - Intergenic
1074300009 10:112225290-112225312 TGGCCTTGCCTGGGAGCTGCTGG + Intergenic
1075312531 10:121426679-121426701 TGAGCTTGTTCTGGAGCTGGTGG + Intergenic
1075637073 10:124036492-124036514 TGACCTGGTCAGGGAGAGGCTGG - Intronic
1075898984 10:126023111-126023133 TGAGCTCGTCAGGGATCTCTGGG - Intronic
1076304146 10:129451742-129451764 TGAGCTGGACAGAGAGCTGCAGG - Intergenic
1076748201 10:132525014-132525036 TGCCCTTGTCAAGGTGCTGCTGG + Intergenic
1077474405 11:2779565-2779587 AGAGCTTGGCAGGGAGTGGCGGG - Intronic
1077481167 11:2815351-2815373 GGGGCTTGTCAGGGAGCTCATGG + Intronic
1078103096 11:8341368-8341390 TTAGGTTGTCCGGAAGCTGCTGG - Intergenic
1080574856 11:33588854-33588876 TGAGTTTCTCAGGGAACTGGGGG + Intronic
1081702056 11:45158377-45158399 CCAGCCTGTCTGGGAGCTGCAGG - Intronic
1081725397 11:45324011-45324033 TGAGCCTGCTAGGCAGCTGCAGG - Intergenic
1083485335 11:62979902-62979924 TGGGCTGGTCATGGACCTGCAGG - Exonic
1083594897 11:63914526-63914548 TCAACTTGTCAGGCAGCTGGAGG + Exonic
1084359663 11:68661242-68661264 TGACCTTGCCAGGGCGGTGCTGG + Intergenic
1084543030 11:69799105-69799127 TGTGCTTCTGAGGGAGATGCTGG + Intergenic
1084594357 11:70108133-70108155 TGAGCTTCTCAGGGAGAAACAGG - Intronic
1085235636 11:75013144-75013166 AGAGCTTGTCAGTGACCTGATGG + Intronic
1086528882 11:87760763-87760785 TAAGCTTTTCAGTGTGCTGCTGG + Intergenic
1089217871 11:116846576-116846598 TGAGGTTGGCAGGGAACTGGGGG + Intronic
1089272841 11:117314178-117314200 TGATATCGTCAGGGAGCAGCAGG - Intronic
1089793380 11:120960578-120960600 TGAGCTAGTGAATGAGCTGCGGG - Intronic
1089978261 11:122751446-122751468 GTGGCTTGTCAGGGAGATGCTGG + Intronic
1090361078 11:126173137-126173159 TGAGCATGTCAGTCAGCAGCTGG + Intergenic
1090902743 11:131047052-131047074 TCAGCTTCCCAGGGAGCTGGGGG - Intergenic
1092946430 12:13458379-13458401 TAAGTCTGTCAGGGAGCTGGAGG - Intergenic
1093447564 12:19277931-19277953 GGTGCTTGACAGGCAGCTGCTGG + Intronic
1093915261 12:24795204-24795226 TCAGCTTGTCATGGGGTTGCAGG + Intergenic
1096428000 12:51520649-51520671 TGAGGATGCCAGGAAGCTGCAGG + Intergenic
1097826032 12:64175633-64175655 TGAACTTAGCAGGGAGATGCAGG - Intergenic
1097959748 12:65520756-65520778 TGAGCATCTCAGGGAATTGCAGG - Intergenic
1101039252 12:100737388-100737410 GGAGTCTGTCAAGGAGCTGCAGG - Intronic
1101571500 12:105958025-105958047 AGATCTTATCAGGAAGCTGCTGG - Intergenic
1104430349 12:128711042-128711064 TGGGCTTGGCAGGTGGCTGCAGG - Intergenic
1105294205 13:19074090-19074112 TGAGCTGGGAAGGGAGCTGTTGG - Intergenic
1106251554 13:27986037-27986059 TGCACTTGTCTGGGAGCAGCTGG - Intronic
1106756807 13:32829912-32829934 TCAGCTTCTCAGGAATCTGCAGG - Intergenic
1107169168 13:37319049-37319071 TTAGCTTGTCAGTGTGTTGCTGG - Intergenic
1108602450 13:52006582-52006604 TGAACTGGGCAGGGAGCTGCGGG - Intronic
1108663664 13:52608226-52608248 TGGCCGTGTCTGGGAGCTGCAGG + Intergenic
1111898433 13:94170421-94170443 TGAGGTTGTGAGGTGGCTGCTGG + Intronic
1113884496 13:113651608-113651630 GGAGCTTGTCAGGGTCGTGCTGG - Intronic
1114776919 14:25494395-25494417 TGAACTTAACAGGGAGATGCTGG + Intergenic
1115334686 14:32233095-32233117 TGGGCTTTTCAGGGAGATGTAGG + Intergenic
1115482593 14:33875899-33875921 ATAGCTTGTCTGGAAGCTGCTGG + Intergenic
1119333009 14:73809545-73809567 TGGGCTTGACAGGCAGATGCAGG - Intergenic
1120759219 14:88271006-88271028 TGAGCGGGTCTGGGTGCTGCTGG - Intronic
1121050406 14:90816193-90816215 TGAGCTCGTCAAGCAGCTGTCGG - Exonic
1121947336 14:98136027-98136049 TGAGCCAGGCAGGGAGCTACAGG - Intergenic
1122470251 14:101961477-101961499 TGGGGCTGTCAGGGTGCTGCTGG - Intergenic
1122840336 14:104458997-104459019 AGAGCTGGCTAGGGAGCTGCTGG + Intergenic
1123039441 14:105484401-105484423 TGAGCAGGTCAGGGTCCTGCCGG - Intergenic
1123165428 14:106320826-106320848 TGAGCATGTCTGGAGGCTGCAGG + Intergenic
1123774516 15:23565792-23565814 TGGGCTTCTGAGGGAGCTGCAGG - Exonic
1126718835 15:51554173-51554195 TCAGCATGTCAGAGAGCTGCTGG - Intronic
1127389684 15:58495326-58495348 TGTTTTTGGCAGGGAGCTGCAGG - Intronic
1129759723 15:78122405-78122427 TGAGCCTCACAGGGAGCTTCGGG - Intronic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130664821 15:85860857-85860879 TGTGCATGTCAGGGGGCTGAGGG + Intergenic
1130991444 15:88878221-88878243 TCAGCTTCTCAGGGTGCTCCAGG + Exonic
1135622535 16:23968233-23968255 TGAGGTTGTCAGGACCCTGCAGG + Intronic
1136746781 16:32597757-32597779 AGAGCTTGTGAGGAAGCTTCTGG + Intergenic
1137310340 16:47250786-47250808 TGAGCAGGTCAGAGAGCTACTGG + Intronic
1137727985 16:50669945-50669967 TGGGCTTGGCAGGGAACTGCCGG + Intronic
1137883109 16:52073277-52073299 TGAGCTTCTCAGGGAGCAGGAGG + Intronic
1138395074 16:56697783-56697805 AGAGGATGCCAGGGAGCTGCTGG + Intronic
1138678691 16:58670070-58670092 TGATCCTCTCAGGGAGGTGCTGG - Intronic
1140861337 16:79020926-79020948 TTAGATTGTCAGGGAGCTAAGGG + Intronic
1142315257 16:89340387-89340409 TCAGCTACTCAGGGGGCTGCAGG - Intronic
1203048911 16_KI270728v1_random:856961-856983 AGAGCTTGTGAGGAAGCTTCTGG + Intergenic
1143139520 17:4733405-4733427 TGAGCCTGTCAGGGTGTTTCTGG - Exonic
1144727109 17:17507470-17507492 TCTGCCTGTCTGGGAGCTGCAGG + Intronic
1145903010 17:28500091-28500113 GGAGCTTGTTAGGGAGCTTGTGG + Intronic
1145925053 17:28640612-28640634 TGACCTGGTCTGGCAGCTGCTGG + Exonic
1146179966 17:30691689-30691711 TCAGCTTCCCAGGGAGCAGCTGG - Intergenic
1147232562 17:39029890-39029912 TGAGCTTGACAGTGACCTGGAGG - Intergenic
1148093877 17:45039234-45039256 TGGGCCTGACAGGGAGCTGCTGG - Intronic
1149927191 17:60713120-60713142 TGTGCTTGTGAGGGAGAAGCAGG + Intronic
1151205160 17:72501474-72501496 TCAGCATGGCAGGGACCTGCAGG + Intergenic
1151341241 17:73472243-73472265 TGAGCAAGTCAGGCAGCTGCAGG + Intronic
1151661508 17:75521588-75521610 TGAGCCTGCATGGGAGCTGCTGG - Intronic
1151721870 17:75861499-75861521 AGAGCCTGGCAGGGAGCAGCAGG + Intergenic
1152264689 17:79287501-79287523 TGAGCATGTCATGGAGCTCCTGG - Intronic
1152447910 17:80356497-80356519 CGAGGTAGTCAGGGTGCTGCTGG - Intronic
1152638529 17:81440005-81440027 TGCCCTTGTCAGCCAGCTGCAGG + Intronic
1154081023 18:11257042-11257064 TGAGCTTTTCAGCCAGTTGCAGG + Intergenic
1155498591 18:26465653-26465675 TGACCGTGTCAGGGTGCTGACGG + Intronic
1156461884 18:37325868-37325890 GGGGCTTGTCAGAGAGGTGCCGG + Intronic
1159477252 18:68937760-68937782 TGGGCCTGTCAGGGGGCTGGTGG - Intronic
1159704914 18:71674838-71674860 GTAGCTTGTCATGGACCTGCAGG - Intergenic
1160497513 18:79383950-79383972 TGGGCCTGCCAGGGGGCTGCAGG - Intergenic
1160799765 19:962363-962385 GGAGGTTGTCAGGGAACAGCAGG - Intronic
1161051620 19:2166872-2166894 TCAGCTTGCCTGGGAGCTCCTGG + Intronic
1161170536 19:2810444-2810466 TGAGCTTCTCCAGGAGCTCCCGG - Exonic
1161270601 19:3387523-3387545 AGAGGGTGTCAGGGAACTGCAGG + Intronic
1162031731 19:7920510-7920532 CGAGCTGGCCCGGGAGCTGCGGG + Exonic
1163232415 19:16013683-16013705 TGACCTTGTCATTGAGCTCCTGG + Intergenic
1164430773 19:28186832-28186854 TGAGCTCCTCAGGTAGCTGCTGG - Intergenic
1164882183 19:31741680-31741702 TCAACGTGGCAGGGAGCTGCAGG - Intergenic
1166761741 19:45228388-45228410 TGAGCTTGTCAAGGTGATGCTGG + Intronic
1167636772 19:50659970-50659992 TCACCATGTCAGGGATCTGCGGG - Intronic
1168590865 19:57633370-57633392 GGAGCTGGACCGGGAGCTGCGGG - Exonic
925098615 2:1227580-1227602 GGAGCTTGTGTGGAAGCTGCAGG - Intronic
925602007 2:5617650-5617672 TGACCTTGTTAGGCAGCTGGTGG + Intergenic
927851262 2:26501123-26501145 TGAGCATGTCTGGTGGCTGCTGG - Intronic
928675010 2:33642065-33642087 TGAGTTTCACAGGGAGGTGCTGG - Intergenic
930552140 2:52849218-52849240 TGAGCTTTTCAACGTGCTGCTGG + Intergenic
933271554 2:80238345-80238367 TGGCCTTGACAGGGAGTTGCTGG + Intronic
937200529 2:120201397-120201419 TGAGGATGTCATGGAGCTACTGG + Intergenic
937220953 2:120343210-120343232 TGAGTTTGTCAAGTAGCTGGTGG + Intergenic
938026483 2:127953496-127953518 TGGGGTTGGCAGGGAGCTGTTGG - Intronic
938305967 2:130254102-130254124 TGTGTTTGTGAGGAAGCTGCCGG + Intergenic
938680691 2:133686961-133686983 TGATCTTGGCAGTTAGCTGCTGG - Intergenic
941539620 2:166766309-166766331 AGATCTTATCAGGAAGCTGCTGG + Intergenic
944532516 2:200681239-200681261 AGAGCCTGTCAGGTAGCAGCTGG - Intergenic
944597660 2:201276237-201276259 TGGGCTGGTCAGGGAGGTCCTGG - Intronic
947534132 2:230930137-230930159 TGGCCTGGACAGGGAGCTGCTGG - Intronic
948643757 2:239391182-239391204 TGCGCTTGTTAGGGACCTGAAGG - Intronic
1171332453 20:24352466-24352488 GGACCTTGTATGGGAGCTGCAGG - Intergenic
1171511300 20:25686623-25686645 TGAGCTTGTCCTGGATTTGCAGG - Exonic
1172408670 20:34706954-34706976 AGAGCTTGGCTGGGGGCTGCTGG - Intronic
1173775954 20:45706427-45706449 TGACCTTGTAAGTGAGTTGCTGG - Intronic
1175963784 20:62649981-62650003 GGAGCTGGGGAGGGAGCTGCAGG - Intronic
1177090410 21:16760474-16760496 GGAGGTTGTCAGCAAGCTGCAGG + Intergenic
1177456229 21:21343550-21343572 AGAGCTTCTCTGGGAGCTGGAGG + Intronic
1178636336 21:34307305-34307327 AGAGCTGGTCAGGCAGCAGCTGG - Intergenic
1178857473 21:36262274-36262296 TGAGCTTTCCCAGGAGCTGCAGG + Intronic
1179959910 21:44762370-44762392 GGAGCTGGACAGAGAGCTGCAGG - Intergenic
1180129711 21:45819741-45819763 AGGGCTTGTCTGGCAGCTGCTGG + Intronic
1180613248 22:17111010-17111032 TGAGCTTGTCAGGGAGCTGCTGG + Exonic
1181018639 22:20086328-20086350 TGAGCTTTACCGAGAGCTGCAGG + Exonic
1181539520 22:23566005-23566027 TGAGTTTGCCTGGAAGCTGCCGG - Intergenic
1182903009 22:33914312-33914334 TTACCTTGTAGGGGAGCTGCTGG - Intronic
1183019679 22:35017347-35017369 TGGGCCTATCAGGGAGCTGTGGG - Intergenic
1184036216 22:41919577-41919599 TGAGGTCGCCAGGGAGCGGCGGG + Intergenic
1184385434 22:44171619-44171641 TCAGCTTCTCAGGGAGGTCCTGG + Intronic
1184479174 22:44737087-44737109 GGAGCGGGGCAGGGAGCTGCGGG - Exonic
1184513348 22:44945752-44945774 TGACCTTGGCAGGAAGCTGTGGG + Intronic
1184851155 22:47121995-47122017 TGTGCATGTCAGCGAGCTGAGGG - Intronic
1185393769 22:50576694-50576716 TGAGGGTCTCAGGGAGTTGCTGG - Intronic
950391453 3:12700027-12700049 CAAGCTTGTCAGGGGGCTGGAGG + Intergenic
953544690 3:43855833-43855855 AGAGCCTGTCAGGGAGCCACTGG - Intergenic
954580848 3:51702296-51702318 TGAGGTGGTCAGGGAGCTGGGGG - Intronic
955355954 3:58232961-58232983 TGAGCTTATCAGAGTGCTGCAGG + Intergenic
956155379 3:66290682-66290704 TAAGCTTGTCGGTGTGCTGCTGG + Intronic
959577955 3:107955150-107955172 TGAGGTTGACAGGCAGTTGCTGG - Intergenic
961390705 3:126550823-126550845 GGAACATGTCAGGGAGCTGAAGG - Intronic
963450943 3:145481314-145481336 AGGGCCTGTCAGGGAGCTGGGGG + Intergenic
967253838 3:187569859-187569881 TGGGCTTGTCAAGAAACTGCTGG + Intergenic
967511805 3:190321914-190321936 TGAGCCCATAAGGGAGCTGCAGG + Intronic
967746035 3:193056343-193056365 TGAGATTCCCAGGGATCTGCAGG + Intergenic
968311094 3:197683549-197683571 TGAGCAGGCCAGGGTGCTGCGGG - Intronic
968312246 3:197693779-197693801 TGAGCTGAACTGGGAGCTGCTGG + Exonic
968392775 4:206632-206654 TGAATTTGTCAGGGACCTTCAGG - Intergenic
969065255 4:4474323-4474345 AGAGCTTGTCAGGCAGTTTCTGG + Intronic
969190477 4:5514343-5514365 TGTGCTTGTAAGGTAGCTGATGG + Intergenic
969335709 4:6508636-6508658 AGATCCTGTCAGGAAGCTGCTGG - Intronic
969718471 4:8879950-8879972 TAACCTTGTCCGGGGGCTGCAGG - Intergenic
970402510 4:15731395-15731417 TGGCCTTGTCACGGTGCTGCTGG + Intronic
971444053 4:26723435-26723457 AGAGTGTGTCAGTGAGCTGCAGG - Intronic
971834692 4:31748251-31748273 TGAGCATGTGAGGGAGGTGGGGG - Intergenic
972001047 4:34033854-34033876 TTGGCTTGTAAGGGAGCTGTGGG - Intergenic
973661277 4:53108989-53109011 TGAGCTTTTCAATGTGCTGCTGG - Intronic
976380560 4:84393869-84393891 TGAGCTCCTCAGGCAGCTGACGG + Intergenic
977277861 4:95000766-95000788 TGAGCTTTTCTTGGTGCTGCTGG - Intronic
978802573 4:112769676-112769698 TGAGTTTGTGAGGGAGTTTCTGG + Intergenic
980414530 4:132467625-132467647 AGAGCATGTCAGGGAGCTAGGGG + Intergenic
980961664 4:139481762-139481784 TGAGCTGGTGTGGTAGCTGCAGG - Intergenic
981569266 4:146134333-146134355 TGTGCTTCTCAGGGAGGGGCTGG + Intergenic
982317219 4:154044035-154044057 TGAACTTATCAAGGGGCTGCTGG + Intergenic
983914341 4:173275487-173275509 TAAGCTTTTCAGTGAGCTGTGGG + Intronic
988599210 5:32623893-32623915 TGAGGTGGCCAGGGAGCTGCAGG + Intergenic
989194555 5:38703709-38703731 TAAGCTTTTCAGTGTGCTGCTGG - Intergenic
991963107 5:72065288-72065310 TGAGTTAGTTAGGGAGATGCTGG - Intergenic
992773505 5:80070248-80070270 TGAGCCTGGCAGGAAGCTGGTGG - Intronic
993632095 5:90299059-90299081 AAAGCTGTTCAGGGAGCTGCTGG + Intergenic
996113640 5:119594470-119594492 TGAGCTTGTCATATAGCTGAGGG + Intronic
998784165 5:145690510-145690532 TGTGGTTGTCATGTAGCTGCAGG - Intronic
1000178503 5:158783562-158783584 TCAGCATGCCAGGGACCTGCCGG + Intronic
1000285070 5:159819844-159819866 GGAGCTTGGCAGGAAGCTGGAGG - Intergenic
1001986242 5:176076126-176076148 AGAGCTTGTGAGGAAGCTTCTGG + Intronic
1002067761 5:176660767-176660789 CAAGCTGATCAGGGAGCTGCTGG - Intergenic
1002230625 5:177761998-177762020 AGAGCTTGTGAGGAAGCTTCTGG - Intronic
1002264709 5:178021750-178021772 AGAGCTTGTGAGGAAGCTTCTGG + Intronic
1003888800 6:10544981-10545003 TGAGGTGGTCAGAGAGCTGCTGG + Intronic
1005022235 6:21429462-21429484 TGAGTTTATCAGGGGCCTGCAGG - Intergenic
1005181992 6:23116268-23116290 GGGGCTTGTCAGGGATATGCAGG - Intergenic
1005741432 6:28794447-28794469 GTAGCTTCTGAGGGAGCTGCAGG + Intergenic
1005744705 6:28825570-28825592 ATAGCTTCTGAGGGAGCTGCAGG + Intergenic
1006169507 6:32085086-32085108 TGAGCTTGACCTGGAGCTGGGGG + Intronic
1006332710 6:33403865-33403887 TGAGCTGGTCCTGAAGCTGCTGG - Exonic
1006332994 6:33405493-33405515 TGAGACTGTCCGGGACCTGCTGG + Exonic
1006408014 6:33856372-33856394 TGGTCTGGTCAGAGAGCTGCAGG - Intergenic
1006421174 6:33935139-33935161 TGATCCTGCCGGGGAGCTGCTGG - Intergenic
1006976522 6:38107464-38107486 TGGGCTTGTCAGGTGCCTGCTGG + Intronic
1007293920 6:40806764-40806786 AGAGCCTCTCAGAGAGCTGCTGG + Intergenic
1007477685 6:42129949-42129971 TGGGCTTGTCAGGAAGATCCTGG + Intronic
1007749483 6:44063203-44063225 TGAGCTGGGCAGGCAGCCGCTGG + Intergenic
1013315916 6:108942995-108943017 GGAGCTTCACAGGAAGCTGCCGG + Intronic
1013429070 6:110039955-110039977 TGAGGTTATGAGGGAGCTGAGGG - Intergenic
1013663734 6:112325701-112325723 TCAGCTTGTCAGGGCGCTGCTGG - Intergenic
1014561087 6:122891597-122891619 TGGGCCTGTCAGGGGGCTGAGGG - Intergenic
1016980155 6:149846467-149846489 TGAGACTGCCAGGGAGCAGCAGG + Intronic
1017055009 6:150428892-150428914 AGTTCTTGTCAGTGAGCTGCTGG + Intergenic
1017074813 6:150607797-150607819 TGAGATGGTCAGGGAGCAGATGG + Intronic
1017824557 6:158071817-158071839 TGAGCTGAGCAGGGAGGTGCTGG - Intronic
1017971177 6:159314159-159314181 TGAGCCTGGCATGGAGCTGCTGG + Intergenic
1019466449 7:1192195-1192217 TGAGAGGGACAGGGAGCTGCAGG - Intergenic
1019572856 7:1721256-1721278 TGATGTTTTCAGGGAGCTACAGG + Intronic
1021864492 7:24941389-24941411 TGAACCTGGCAGGGAGCAGCAGG - Intronic
1022822952 7:33979348-33979370 TCAGGTTCTCAGGGAGTTGCAGG - Intronic
1025997499 7:66537223-66537245 TGAGCACCTCAGAGAGCTGCAGG - Intergenic
1026990377 7:74581699-74581721 TGAGCATCTCGGAGAGCTGCAGG - Intronic
1027654975 7:80919222-80919244 AGAGCCTGGCAGGGAGCCGCGGG + Exonic
1032310032 7:130777452-130777474 TTAGCTTTTCAATGAGCTGCTGG + Intergenic
1033515580 7:142102281-142102303 TGAGCTGGTTAGGAAGATGCTGG + Intronic
1035066052 7:156105761-156105783 TGAGATTGTCAGCAAGCTCCAGG + Intergenic
1035763139 8:2084748-2084770 TGAGCTTTTGAGGGAGGAGCAGG + Intronic
1037257924 8:16976212-16976234 TAAGCTTTTCAGTGTGCTGCTGG + Intergenic
1037901917 8:22693439-22693461 TGAGCTTGCTAGGAAGCGGCGGG - Intergenic
1039892340 8:41694063-41694085 TGAGCTTGTCACTAAGCTCCTGG - Exonic
1040958831 8:53009013-53009035 TTAGCTTTTCAAGGAACTGCCGG + Intergenic
1043431363 8:80198124-80198146 TGACATTGACAGGGACCTGCAGG - Intronic
1047152905 8:122284737-122284759 GGATCTTTTCAGGAAGCTGCTGG - Intergenic
1049180128 8:141217946-141217968 TGAGCTTCTCCGTGAGCCGCAGG + Intronic
1049341338 8:142114200-142114222 TGCTCATCTCAGGGAGCTGCTGG - Intergenic
1049916461 9:322759-322781 TGAGCATGCCAGGCAGCAGCTGG + Intronic
1053105744 9:35406367-35406389 AGTGCTTGTCGGGGACCTGCCGG - Intergenic
1056709362 9:88978167-88978189 TGGGCTTGACAGGAAGCTGATGG - Intergenic
1056719655 9:89060799-89060821 GGAGCCTGTCAGGGGGCAGCAGG + Intronic
1056945810 9:90995562-90995584 TTAGCTTTTCAGTGTGCTGCTGG + Intergenic
1057265661 9:93615894-93615916 TGAGCTGGGAAGGGAGCTGTCGG + Intronic
1060041247 9:120303611-120303633 TGAGATGATCAGGGATCTGCTGG + Intergenic
1060157094 9:121327424-121327446 GGAGCTGCTCAGGGTGCTGCGGG + Exonic
1061061734 9:128254034-128254056 TCAGCTGGTCGGGGGGCTGCAGG - Intronic
1062128980 9:134882542-134882564 TGAGCTTGTCAGAGCCCTCCAGG - Exonic
1062134263 9:134916423-134916445 TGAGCTTGTCAGAGCCCTCCAGG + Exonic
1062141475 9:134961445-134961467 TGAGCTTGGCAGGAAGCCCCAGG - Intergenic
1062639906 9:137513924-137513946 TGAGCTTGCCGGTGACCTGCGGG + Intronic
1185717026 X:2351069-2351091 GGGGCCTGTCAGGGAGCTGGGGG + Intronic
1187412505 X:19063337-19063359 TGAGCATGTCACTGAGGTGCAGG - Intronic
1187855315 X:23631359-23631381 TGAGCCTCTCTGGGGGCTGCTGG + Intergenic
1188905777 X:35789470-35789492 AGATCTTATCAGGAAGCTGCTGG + Intergenic
1189009384 X:37031017-37031039 TAAGCTTTTCAGGGTGCTGCTGG + Intergenic
1189039210 X:37524715-37524737 TAAGCTTTTCAGGGTGCTTCTGG - Intronic
1189253997 X:39623227-39623249 TGAGTTTGTCAGGGATATGGTGG + Intergenic
1195603368 X:106773845-106773867 TGAGCATATCAGGGGGCTGAGGG - Intronic
1195994008 X:110713138-110713160 TGACCTAGTCAGGGAGGTGAAGG - Intronic
1200055137 X:153456300-153456322 GGAGCTTGCCAGGCAGCTGCAGG - Exonic
1200925857 Y:8654090-8654112 TGAGATTGTGAGGTGGCTGCTGG - Intergenic