ID: 1180614202

View in Genome Browser
Species Human (GRCh38)
Location 22:17117318-17117340
Sequence CTGGAAGCACAGATTGTGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180614191_1180614202 27 Left 1180614191 22:17117268-17117290 CCAATTAAGTGTGAAATCCAGCC 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 220
1180614201_1180614202 -6 Left 1180614201 22:17117301-17117323 CCACATAGGGTGAGGGACTGGAA 0: 1
1: 0
2: 1
3: 7
4: 130
Right 1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 220
1180614197_1180614202 6 Left 1180614197 22:17117289-17117311 CCAGCTATTGGGCCACATAGGGT 0: 1
1: 0
2: 2
3: 3
4: 41
Right 1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 220
1180614194_1180614202 10 Left 1180614194 22:17117285-17117307 CCAGCCAGCTATTGGGCCACATA 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180614202 Original CRISPR CTGGAAGCACAGATTGTGCA TGG Exonic
900519153 1:3097365-3097387 CTGGAAGCCCAGAGTGTGCTGGG - Intronic
900704118 1:4068196-4068218 CTGGAAGCCCAGAGTGGGCCTGG + Intergenic
903513848 1:23896713-23896735 CAGGAAGCTGAGATTGTGCCAGG + Intronic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
908393206 1:63702256-63702278 CTGAAAGCACAGATTGTTTTCGG - Intergenic
915348088 1:155208194-155208216 CTGGAAGCCACGATTGTGGAAGG + Intronic
919738686 1:200969820-200969842 GTGCAAGGACAGATTTTGCAGGG - Intronic
920185504 1:204156761-204156783 CTGGGAGGACAGATTGTGCTGGG - Exonic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921577011 1:216847171-216847193 CTAGTAGCACAAATTGTGCACGG - Intronic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
1063809920 10:9693046-9693068 CTGGAAGCACAGCATCTACAAGG + Intergenic
1065011555 10:21425545-21425567 CTAGAAGGACAGACTGGGCATGG + Intergenic
1065311466 10:24419777-24419799 GTGGAAGCCCAAAATGTGCATGG - Intronic
1067061124 10:43078393-43078415 CTGGAAACTCAGTTTGTGCAGGG - Intronic
1068799011 10:61118285-61118307 GTGCAAGCAGAGATTGTGAATGG - Intergenic
1069540724 10:69292004-69292026 CTGGAAGCTCAGACTGTCTATGG + Intronic
1070339896 10:75488365-75488387 CTGAAAGCTCAGAGTGTGCTTGG + Intronic
1071431798 10:85612416-85612438 CTGGAGGCTCAGATAGTACAGGG - Intronic
1073030197 10:100519731-100519753 CTGGTAGCAGAGATTGCGCTGGG - Intronic
1074297496 10:112204098-112204120 CTGGAGGCACTGATTAGGCACGG - Intronic
1074696636 10:116055721-116055743 CTGTCAGCACAGATGGTGCGGGG - Intergenic
1075034287 10:119050202-119050224 CTGGAATCCCAGATTGCTCAGGG - Intronic
1077299665 11:1841138-1841160 CTCGAAGCACAAGGTGTGCATGG + Exonic
1078055960 11:8009136-8009158 TGGGAAGCACAGTTTCTGCAAGG + Intergenic
1080886432 11:36372342-36372364 CTGGAAGAACAGAATCTGAAAGG + Intronic
1080962095 11:37172617-37172639 CTGGAAGCATAGTCTGTGGAAGG + Intergenic
1083674072 11:64315920-64315942 CTCCAAGAACAGCTTGTGCATGG - Exonic
1083920383 11:65779092-65779114 CTGGAAGCAGAGAGTGGCCAAGG + Exonic
1084561696 11:69909218-69909240 CTGTAAGCACTTACTGTGCACGG + Intergenic
1084749324 11:71193784-71193806 CTGCAGGCACAGATTGTTCCAGG + Intronic
1085037866 11:73310488-73310510 CTGGAAGCCCTGACTGGGCAGGG + Exonic
1087190302 11:95247373-95247395 CTGGAATCACAATTTGTGGAAGG - Intergenic
1087551606 11:99657396-99657418 CCGGAAGTACACATTGGGCAGGG + Intronic
1091319048 11:134636843-134636865 CTGGATGAACAGCTTGTGAAGGG + Intergenic
1092285080 12:7124037-7124059 CTTCAAGCCCAGATTGTGCCAGG - Exonic
1092893196 12:12988850-12988872 CTGGTAGCTCAGATTCTGCTGGG - Intronic
1095310786 12:40693764-40693786 CTGGAAGCACTGAGTGGGCGGGG + Intronic
1095454259 12:42365613-42365635 CTGCAATCACAGATGGTTCAAGG + Intronic
1095706428 12:45242225-45242247 CGGGAAGCTCAAATTGGGCAGGG - Intronic
1096231545 12:49899556-49899578 CTGAAAGAATAGAATGTGCAGGG - Intronic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1097885027 12:64720428-64720450 CTGAAGGCACAGGGTGTGCAGGG - Intronic
1097942909 12:65331878-65331900 CTGGAAGCAGAGAAACTGCATGG + Intronic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1105344354 13:19560037-19560059 CTCCAAGAACAGCTTGTGCATGG + Intergenic
1105535680 13:21261537-21261559 CTCCAAGAACAGCTTGTGCATGG - Intergenic
1106329349 13:28725064-28725086 CTCTAAGCACAAATTGTGGAAGG + Intergenic
1107250951 13:38362132-38362154 CTGGAAGCAGGGATTGTGTCTGG + Intronic
1108002046 13:45912664-45912686 CTGGAAGCACAGCTTGAAGATGG - Intergenic
1108731718 13:53242274-53242296 CTGGAAGCACCCTCTGTGCAGGG - Intergenic
1109398937 13:61798831-61798853 ATGGTAACACAAATTGTGCATGG - Intergenic
1110019420 13:70451247-70451269 CAGGAAAGACAGTTTGTGCAGGG - Intergenic
1110886977 13:80651990-80652012 CTGGAAAAAGAGATTTTGCAGGG + Intergenic
1111797776 13:92945322-92945344 CTGGGAGCATGGATTGTGGATGG + Intergenic
1118312185 14:64702454-64702476 CTGGAAGCAGTGATGGTGAAGGG + Intergenic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1121081745 14:91114203-91114225 AGGGAAGCACACATTCTGCAAGG + Intronic
1121260149 14:92559924-92559946 CTGGGAGCACAGAGTGAGCCTGG + Intronic
1121407187 14:93726201-93726223 GTGGAGGCACAGTTTCTGCAGGG - Intronic
1122897759 14:104768914-104768936 CAGGAAGGACAGATAGGGCAGGG - Intergenic
1123133602 14:106007676-106007698 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1123583626 15:21738122-21738144 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1123620276 15:22180725-22180747 CTGGAAGGACAGATCTTGGAGGG + Intergenic
1126181579 15:45790727-45790749 AAGGAAGACCAGATTGTGCAGGG - Intergenic
1126445571 15:48740017-48740039 CTTGAAGCTGAGATTGTTCAGGG - Intronic
1127661046 15:61100473-61100495 CTGGAAGAACAGGCTGTACATGG + Intronic
1130011767 15:80157874-80157896 CTGGAAGCAGAGATGGCACAAGG + Intronic
1130101354 15:80896648-80896670 CTGGAATCACAGATTGTTGAAGG + Intronic
1130294041 15:82630710-82630732 CTGGAGGGACAGAATGTGCCTGG + Intronic
1130862216 15:87901099-87901121 CTGGAATCCCAGATGCTGCATGG - Intronic
1131155210 15:90070889-90070911 CTGCAAGGAGTGATTGTGCAGGG + Intronic
1131676441 15:94675001-94675023 ATGGAAGGACAGATTTTGCCAGG - Intergenic
1132419021 15:101648587-101648609 CTGGAAGCACAGAGCGTACTTGG - Intronic
1132562085 16:600202-600224 CTGGAAGTACAGACTGTTCCAGG - Intronic
1132891898 16:2208736-2208758 CTGGAGGGGGAGATTGTGCAGGG - Intronic
1133393219 16:5425966-5425988 CTGGAAGGAGAGAGTGTGCAGGG + Intergenic
1135858798 16:26036404-26036426 CAGGAAATACAGATTGGGCAGGG - Intronic
1136007255 16:27339521-27339543 ATGGAAGCACAGCTTGCTCAAGG + Intronic
1136022876 16:27451089-27451111 GTGGAAACACAGCTTCTGCACGG + Exonic
1137828903 16:51525232-51525254 CTGGGAGCAAAGATTTGGCAAGG + Intergenic
1138079917 16:54080897-54080919 CTGGAAGAACAGCTCGTGCTTGG + Intronic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139212860 16:65097776-65097798 CTGGAAGTAGAGAATGTGAAAGG - Intronic
1141725284 16:85783943-85783965 CTGAAAGCCTTGATTGTGCAGGG - Intronic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1145964913 17:28910133-28910155 CTGGAAGCTCAGATTCTCCATGG + Intronic
1147119772 17:38329210-38329232 CAGGAAGCTCAGAGTGTTCAGGG - Exonic
1148849878 17:50549398-50549420 CTGGAAGCAGCGATTGTTCACGG - Exonic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1152198867 17:78933764-78933786 CTGCAAGGACAGTTTGAGCAGGG + Intergenic
1152258112 17:79252072-79252094 CTGGAAGCACACTTTGTCCTGGG + Intronic
1155619989 18:27767678-27767700 CAGGTAGCACAGCTTGTACAAGG + Intergenic
1156200051 18:34820561-34820583 ATGGAAGCAGGCATTGTGCATGG - Intronic
1162747312 19:12806067-12806089 TAGGAAGCACAGATCTTGCACGG + Intronic
1163067510 19:14809865-14809887 CTGCCTGCACCGATTGTGCAAGG - Intronic
1163645688 19:18487838-18487860 CTGAAAGTACAGATTGTACCGGG - Intronic
925718559 2:6807068-6807090 CTGGAGGCATAGGATGTGCAGGG + Intergenic
927445948 2:23161712-23161734 CTGGTAGCACTGAATGGGCAAGG - Intergenic
927813210 2:26191942-26191964 CTGGAAGGACAGATTCTCCTTGG - Intronic
927883362 2:26704304-26704326 CTGAATGCACAGCTTCTGCATGG + Intronic
928868938 2:35951595-35951617 ATGGAAGCACAGAATTTCCAAGG - Intergenic
932973211 2:76571056-76571078 CTCTCAGCACAGATTGGGCAGGG + Intergenic
937271542 2:120656068-120656090 CTGGAAGATGAGATTGTGGATGG + Intergenic
937276550 2:120688168-120688190 CTTGAAGCAGAGACTTTGCAAGG + Intergenic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
942237831 2:173929590-173929612 CAGGCTGAACAGATTGTGCAAGG + Intronic
942980392 2:182073775-182073797 CTGAAGGCACAGAATGTGAATGG + Intronic
943720311 2:191197251-191197273 CTGGAAGCACATATTTTGAGAGG - Intergenic
944373947 2:199018065-199018087 GTGGATGCACAGATTCTGGATGG + Intergenic
946300822 2:218823030-218823052 CTGGGAGCACAGGTAGGGCAAGG + Exonic
946316208 2:218914789-218914811 GTGGAAGCAAAGAGTGTGAAGGG - Intergenic
946337187 2:219045766-219045788 CTGGAAGCCCACATTGTGCCAGG + Intergenic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
947083379 2:226423567-226423589 GAGGAAGCACAGACTGGGCAGGG - Intergenic
1168804124 20:662800-662822 GTGGAAGCCCAGGTTGTGCCGGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171481320 20:25457960-25457982 CTCGGAGCACAGACTGTGGAGGG - Intronic
1171720486 20:28557600-28557622 CAGGGAATACAGATTGTGCATGG - Intergenic
1171784803 20:29453049-29453071 CAGGGAATACAGATTGTGCATGG - Intergenic
1171863585 20:30424590-30424612 CAGGGAATACAGATTGTGCATGG + Intergenic
1172813651 20:37669694-37669716 CTGGCAGCAGAGATTGGGAAGGG + Intergenic
1173361265 20:42346650-42346672 CTGGTAGAACTGAGTGTGCAGGG - Intronic
1173431968 20:42996142-42996164 CTGGAAGCACACTTGGTGCTGGG - Intronic
1174409560 20:50325448-50325470 CTGGAAGCAGGGATAGTTCAGGG + Intergenic
1177144630 21:17394015-17394037 CTGGAAGGAAAGATTTTGAACGG - Intergenic
1180614202 22:17117318-17117340 CTGGAAGCACAGATTGTGCATGG + Exonic
1181776709 22:25165390-25165412 CTGGAAGCAGTGTTTGTTCAGGG + Intronic
1182123296 22:27800275-27800297 CTGCAAGCGCAGCCTGTGCACGG - Exonic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
1183818649 22:40325606-40325628 CTGGAAGCAGAGCTTTTGCATGG - Exonic
1185150819 22:49163043-49163065 TCGGAAGCTCAGATTTTGCAAGG - Intergenic
949180727 3:1127877-1127899 CATGAAACACAGATTGTTCAAGG + Intronic
949519702 3:4838888-4838910 CTGAAAGGACAGATAGTGTAGGG - Intronic
950140523 3:10612061-10612083 CTGGAAGCTCAGAGTGTGGTTGG - Intronic
951709321 3:25573186-25573208 CTGGAAGAACAGAGTGGGCAGGG - Intronic
954337155 3:49925955-49925977 TAAGAAGCACAGATTATGCAGGG - Intronic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
960613281 3:119574195-119574217 ATGGAAGCAGAGAATGTTCAAGG - Intergenic
960956955 3:123039368-123039390 ATGGAAGCCGAGATTGTCCATGG + Intergenic
961099268 3:124184895-124184917 CTGGAAGCAGGGATTTTGAAGGG + Intronic
964736746 3:159925951-159925973 CAGGGAGCTCAGCTTGTGCATGG - Intergenic
968434963 4:579680-579702 CTGGGACCACAGACTGTACAAGG - Intergenic
969182212 4:5450957-5450979 CAAGAAGCACAGAGTGTGGATGG - Intronic
969182378 4:5452102-5452124 CAAGAAGCACAGAATGTGGATGG - Intronic
969429772 4:7147385-7147407 CTGGAAGCTCAGTGGGTGCAGGG + Intergenic
970136889 4:12935143-12935165 GTGGAAGCACAGATCATGAATGG + Intergenic
977078929 4:92497712-92497734 CTGGAAAAAAAGATTGTGCAGGG - Intronic
977295268 4:95202669-95202691 CTGGAAGCCAAGGTTTTGCACGG - Intronic
979183888 4:117763501-117763523 GAGGAGGCACAGAGTGTGCATGG - Intergenic
982823701 4:159976472-159976494 CTGGAAGCCCAGATATTGAAGGG + Intergenic
983661011 4:170130933-170130955 TTGGAAGCACAAATTCAGCAGGG - Intergenic
985309834 4:188585672-188585694 CTGGATGCTCAGATTCTGCTGGG + Intergenic
986022213 5:3814964-3814986 TTGGAAGCACATAATGTGTAAGG - Intergenic
986414881 5:7518662-7518684 CAGGAAGCCTAGATTGGGCATGG - Intronic
986836695 5:11646917-11646939 CTGGAAGCACTGTGTGTGCAGGG - Intronic
988225400 5:28405664-28405686 CTAGAAGAACAGATTGTTCCTGG - Intergenic
988489539 5:31694673-31694695 CTGGAAGGACAGAGTGTGTTTGG - Intronic
991385129 5:66079107-66079129 CTGGAAGCAAAGAATGGGGATGG + Intronic
1000676529 5:164128627-164128649 CTCGAAGTACTGTTTGTGCATGG - Intergenic
1001644277 5:173268754-173268776 CTGGAAGCTCAGAATTTTCATGG + Intergenic
1003645802 6:7911839-7911861 CTGGAAGAACAGACTTTGGAGGG - Intronic
1005129508 6:22489126-22489148 CTGGAAGCTCAGAATGTCAAAGG + Intergenic
1005810400 6:29510969-29510991 CTGCACACTCAGATTGTGCAGGG - Intergenic
1006912404 6:37571934-37571956 CGGTGAGCACAGATGGTGCAAGG - Intergenic
1007649217 6:43407503-43407525 TTGGGAGCACAGACTGTTCAAGG + Intergenic
1007762165 6:44139502-44139524 CTGAAAGGACAGGTAGTGCACGG - Exonic
1007915268 6:45555762-45555784 CTGTGAGCTCAGGTTGTGCAGGG + Intronic
1009278503 6:61716887-61716909 TTTGAAGCACTGATTGTGTATGG + Intronic
1011481326 6:87796661-87796683 TTGGAAGCATATATTCTGCAAGG + Intergenic
1011735695 6:90308846-90308868 ATGGCAGAACAGAGTGTGCAGGG + Intergenic
1013787781 6:113801055-113801077 CTGGAAGCAAACACTGTGCTAGG + Intergenic
1014962873 6:127708285-127708307 CTGGAAACACAGTATGTGAAAGG + Exonic
1015473068 6:133628398-133628420 CTAGAAACAGAGATTATGCATGG + Intergenic
1016311003 6:142733590-142733612 TTGGGAGCAGAGAGTGTGCAGGG - Intergenic
1016569821 6:145498783-145498805 CTGGAAGCAGCTATGGTGCATGG - Intergenic
1017092280 6:150770765-150770787 CTGGAAGGAGAAACTGTGCAGGG - Intronic
1020084726 7:5304068-5304090 CTGCAAGCAGAGTTTGTGCGTGG + Exonic
1022483555 7:30759991-30760013 CTGGAAGGAGAGAGTGGGCAAGG + Intronic
1022514468 7:30966481-30966503 CAGAAAGCACAGCATGTGCAAGG - Intronic
1022703245 7:32780850-32780872 CTGAAAGCAGAGGTTGTGAATGG + Intergenic
1023283427 7:38594432-38594454 CTGGTATCAGACATTGTGCAAGG + Intronic
1023464557 7:40439757-40439779 CTGAAAGCACAGCATGAGCATGG - Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024054668 7:45652329-45652351 CTGGAACCACGGAATCTGCATGG - Intronic
1024764578 7:52642028-52642050 TTAGAAGCACAGATTTTGAAAGG - Intergenic
1024989994 7:55225871-55225893 CAGGAAGAACAGCTAGTGCATGG - Intronic
1025209581 7:57013132-57013154 CTGCAAGCAGAGTTTGTGCATGG - Intergenic
1025591718 7:62868774-62868796 CTGGAAACACTGTTTGGGCAGGG + Intergenic
1025662370 7:63563718-63563740 CTGCAAGCAGAGTTTGTGCATGG + Intergenic
1026845893 7:73699083-73699105 CTGGGACCACAGGTTGTGCCTGG - Intronic
1028602001 7:92611857-92611879 CAGGAAGCACACACTGTGAATGG - Exonic
1029105461 7:98171647-98171669 CAGGAAGTGCAGCTTGTGCATGG - Exonic
1029220159 7:98982355-98982377 CAGAAAGCACAGATTGTTCTAGG + Intronic
1030814086 7:114012880-114012902 ATGGAAACTAAGATTGTGCAAGG - Intronic
1033304280 7:140213017-140213039 CTGGGATTACAGATTGTGCCCGG - Intergenic
1033436271 7:141336208-141336230 CTGGAAGTACAGAGTGGCCAGGG - Intronic
1033443503 7:141400825-141400847 CAAGAAACACAGAGTGTGCAAGG + Intronic
1033957742 7:146872744-146872766 CTGTATGCACAAATTGTTCAAGG + Intronic
1035756049 8:2033870-2033892 CTGGGAGCTCAGATAGGGCAAGG - Intergenic
1037417391 8:18666744-18666766 CTGGAAGCACACATTATTCAAGG + Intronic
1038220601 8:25603501-25603523 CTGGAAGCAGAGGATGTGCCTGG + Intergenic
1039069871 8:33640108-33640130 CTGGAAGTAGAGATTGTCCCTGG - Intergenic
1040807304 8:51408696-51408718 CCGGAACCACAGGGTGTGCATGG + Exonic
1043508435 8:80925566-80925588 GTGGAAGCAGAGAATGTCCAGGG + Intergenic
1046612370 8:116440275-116440297 CTGGAAGCTCAGAGAGTGAAGGG - Intergenic
1046763023 8:118041242-118041264 CAGAAAGCAGAGATGGTGCAGGG + Intronic
1047241882 8:123098279-123098301 CTGGAAGAATAGAAGGTGCAAGG - Intronic
1049054806 8:140227649-140227671 CTGAAAGCAGAATTTGTGCAGGG + Intronic
1051861203 9:21627148-21627170 CTGAAAACACAGAATTTGCATGG + Intergenic
1055693237 9:78856643-78856665 CTGGCACCACAGAATATGCAAGG - Intergenic
1057798685 9:98176057-98176079 CTAGAAGCACAAAGTGTTCATGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058227026 9:102377453-102377475 CTGGAAGCAGACATTGTCAAGGG - Intergenic
1059401043 9:114070895-114070917 CTGGAAGCACCCCTTGGGCAGGG + Intronic
1061317265 9:129803968-129803990 CAAGAAGCACAGATTATCCAGGG - Intronic
1062150612 9:135016930-135016952 CTGGGGGCCCAGATTGTGCAGGG + Intergenic
1203445593 Un_GL000219v1:52219-52241 CAGGGAATACAGATTGTGCATGG - Intergenic
1185797606 X:2980384-2980406 CAGGCAGCAGAGCTTGTGCAGGG - Intergenic
1189885465 X:45540041-45540063 TTCGAAGCACAGTTTGTGTAAGG - Intergenic
1192051903 X:67732231-67732253 CTGAAGGCACAGACAGTGCATGG - Intergenic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1196180266 X:112681860-112681882 CTGGAATAAGAGATTCTGCAAGG + Intergenic
1200526918 Y:4285064-4285086 GTGGAATCACAGATAGTACATGG - Intergenic
1200684890 Y:6249286-6249308 ATGGAAGCAGAGATAGTTCAAGG + Intergenic
1200990420 Y:9340557-9340579 ATGGAAGCAGAGATAGTTCAAGG + Intergenic
1200993082 Y:9360874-9360896 GTGGAAGCAGAGATAGTTCAAGG + Intronic
1200995736 Y:9381144-9381166 GTGGAAGCAGAGATAGTTCAAGG + Intergenic
1200998401 Y:9401496-9401518 GTGGAAGCAGAGATAGTTCAAGG + Intergenic
1201000909 Y:9470026-9470048 GTGGAAGCAGAGATAGTTCAAGG + Intronic
1201003577 Y:9490354-9490376 ATGGAAGCAGAGATAGTTCAAGG + Intergenic
1201006233 Y:9510636-9510658 ATGGAAGCAGAGATAGTTCAAGG + Intergenic
1201008891 Y:9530945-9530967 GTGGAAGCAGAGATAGTTCAAGG + Intergenic
1201647855 Y:16255047-16255069 CAGGAAGCACAGATTCCCCATGG - Intergenic
1201654955 Y:16330254-16330276 CAGGAAGCACAGATTCCCCATGG + Intergenic